Searching the RRID Resource Information Network

Our searching services are busy right now. Please try again later

  • Register
X
Forgot Password

If you have forgotten your password you can enter your email here and get a temporary password sent to your email.

X

Leaving Community

Are you sure you want to leave this community? Leaving the community will revoke any permissions you have been granted in this community.

No
Yes

Integrated Animals is a virtual database currently indexing available animal strains and mutants from: AGSC (Ambystoma), BCBC (mice), BDSC (flies), European Xenopus Resource Center (frog), The National Xenopus Resource (frog), Xenopus Express (frog), CWRU Cystic Fibrosis Mouse Models (mice), DGGR (flies), FlyBase (flies), IMSR (mice), MGI (mice), MMRRC (mice), NSRRC (pig), RGD (rats), Sperm Stem Cell Libraries for Biological Research (rats), Tetrahymena Stock Center (Tetrahymena), WormBase (worms), XGSC (Xiphophorus), ZFIN (zebrafish), and ZIRC (zebrafish). Note, the IMSR data is linked, but users may need to re-execute the search if the top mouse is not returned properly.
Note: BCBC is no longer in service, so the links may not be functional.

Suggested Search Criteria

Enter extra filters to help narrow your search

Search

Type in a keyword to search

On page 153 showing 3041 ~ 3060 out of 147,344 results
Snippet view Table view Download Top 1000 Results
Click the to add this resource to a Collection
  • RRID:WB-STRAIN:WBStrain00004984

http://www.wormbase.org/db/get?name=WBStrain00004984

Source Database: WormBase (WB)
Affected Genes: WBGene00001072(dpy-10)|WBGene00006744(unc-4)
Genomic Alteration: WBGene00001072(dpy-10), WBGene00006744(unc-4)
Availability: available
Source References: EMPTY
Synonyms: unc-4(e120)/mIn1 [dpy-10(e128) umnIs43] II.
Alternate IDs: WB-STRAIN:CGC53, CGC_CGC53
Notes: umnIs43 [myo-2p::mKate2 + NeoR, II: 11755713 (intergenic)] II. Heterozygotes are wild-type mKate2+, and segregate wild-type mKate2, Unc-4 non-mKate2, and Dpy mKate2+ mIn1 homozygotes. Maintain by picking wild-type mKate2+ and check for correct segregation of progeny to maintain. Derived by insertion of myo-2p::mKate2 transgene into mIn1 balancer in parental strain DR1785 using CRISPR/Cas9.

Proper citation: RRID:WB-STRAIN:WBStrain00004984 Copy   


  • RRID:WB-STRAIN:WBStrain00004982

http://www.wormbase.org/db/get?name=WBStrain00004982

Source Database: WormBase (WB)
Affected Genes: WBGene00001063(dpy-1)
Genomic Alteration: WBGene00001063(dpy-1)
Availability: available
Source References: EMPTY
Synonyms: sC1(s2023) [dpy-1(s2170) umnIs41] III.
Alternate IDs: WB-STRAIN:CGC51, CGC_CGC51
Notes: umnIs41 [myo-2p::mKate2 + NeoR, III: 518034 (intergenic)] III. Dpy mKate2+. Derived by insertion of myo-2p::mKate2 transgene into parental strain BC4279 using CRISPR/Cas9.

Proper citation: RRID:WB-STRAIN:WBStrain00004982 Copy   


  • RRID:WB-STRAIN:WBStrain00004918

    This resource has 1+ mentions.

http://www.wormbase.org/db/get?name=WBStrain00004918

Source Database: WormBase (WB)
Availability: available
Source References: EMPTY
Synonyms: sEx11128.
Alternate IDs: WB-STRAIN:CF2893, CGC_CF2893
Notes: sEx11128 [gpd-2p::GFP + (pCeh361)dpy-5(+)]. Pick GFP+ animals to maintain. Derived by outcrossing BC11128 2x to wild-type to remove dpy-5(e907). Reference: Zhang P, et al. Cell Metab. 2013 Jan 8;17(1):85-100.

Proper citation: RRID:WB-STRAIN:WBStrain00004918 Copy   


  • RRID:WB-STRAIN:WBStrain00004916

http://www.wormbase.org/db/get?name=WBStrain00004916

Source Database: WormBase (WB)
Affected Genes: WBGene00000169(aqp-1)
Genomic Alteration: WBGene00000169(aqp-1)
Availability: available
Source References: EMPTY
Synonyms: aqp-1(tm2309) II.
Alternate IDs: WB-STRAIN:CF2885, CGC_CF2885
Notes: Homozygous viable, but short-lived. Reference: Lee SJ, et al. Cell Metab. 2009 Nov;10(5):379-91.|"Made_by: Seung-Jae Le"|"Mutagen:TMP+UV"|"Mutagen:TMP/UV"

Proper citation: RRID:WB-STRAIN:WBStrain00004916 Copy   


  • RRID:WB-STRAIN:WBStrain00004917

http://www.wormbase.org/db/get?name=WBStrain00004917

Source Database: WormBase (WB)
Availability: available
Source References: EMPTY
Synonyms: sEx10466.
Alternate IDs: WB-STRAIN:CF2892, CGC_CF2892
Notes: sEx10466 [nnt-1p::GFP + (pCeh361)dpy-5(+)]. Pick GFP+ animals to maintain. Derived by outcrossing BC10466 2x to wild-type to remove dpy-5(e907). Reference: Zhang P, et al. Cell Metab. 2013 Jan 8;17(1):85-100.

Proper citation: RRID:WB-STRAIN:WBStrain00004917 Copy   


  • RRID:WB-STRAIN:WBStrain00004910

http://www.wormbase.org/db/get?name=WBStrain00004910

Source Database: WormBase (WB)
Affected Genes: WBGene00001609(glp-1)|WBGene00013955(kri-1)
Genomic Alteration: WBGene00001609(glp-1), WBGene00013955(kri-1)
Availability: available
Source References: EMPTY
Synonyms: kri-1(ok1251) I; glp-1(e2141) III; muEx353.
Alternate IDs: WB-STRAIN:CF2310, CGC_CF2310
Notes: muEx353 [kri-1(cDNA, a-isoform)::GFP + odr-1p::RFP]. Pick RFP+ to maintain. Temperature sensitive. Sterile at 25C; maintain at 15-20C. Reference: Berman JR and Kenyon C. Cell. 2006 Mar 10;124(5):1055-68.

Proper citation: RRID:WB-STRAIN:WBStrain00004910 Copy   


  • RRID:WB-STRAIN:WBStrain00004998

http://www.wormbase.org/db/get?name=WBStrain00004998

Source Database: WormBase (WB)
Affected Genes: WBGene00001072(dpy-10)|WBGene00001076(dpy-17)|WBGene00006744(unc-4)
Genomic Alteration: WBGene00001072(dpy-10), WBGene00001076(dpy-17), WBGene00006744(unc-4)
Availability: available
Source References: EMPTY
Synonyms: mT1/unc-4(e120) II; mT1 [dpy-10(e128) umnIs54]/dpy-17(e164) III.
Alternate IDs: WB-STRAIN:CGC68, CGC_CGC68
Notes: umnIs54 [myo-2p::GFP + NeoR, II: 11755713 (intergenic)] III. Heterozygotes are wild-type GFP+, and segregate wild-type GFP+, DpyUnc non-mGFP, sterile Dpy GFP+ mT1 homozygotes, and large numbers of arrested aneuploid embryos. Maintain by picking wild-type GFP+ and check for correct segregation of progeny to maintain. Derived by insertion of myo-2p::GFP transgene into mT1 balancer in parental strain DR1832 using CRISPR/Cas9.

Proper citation: RRID:WB-STRAIN:WBStrain00004998 Copy   


  • RRID:WB-STRAIN:WBStrain00004996

    This resource has 1+ mentions.

http://www.wormbase.org/db/get?name=WBStrain00004996

Source Database: WormBase (WB)
Affected Genes: WBGene00001072(dpy-10)|WBGene00001076(dpy-17)|WBGene00006744(unc-4)
Genomic Alteration: WBGene00001072(dpy-10), WBGene00001076(dpy-17), WBGene00006744(unc-4)
Availability: available
Source References: EMPTY
Synonyms: unc-4(e120)/mT1 [umnIs52] II; mT1 [dpy-10(e128)]/dpy-17(e164) III.
Alternate IDs: WB-STRAIN:CGC66, CGC_CGC66
Notes: umnIs52 [myo-2p::mKate2 + NeoR, III: 8856215 (intergenic)] II. Heterozygotes are wild-type mKate2+, and segregate wild-type mKate2+, DpyUnc non-mKate2, sterile Dpy mKate2+ mT1 homozygotes, and large numbers of arrested aneuploid embryos. Maintain by picking wild-type mKate2+ and check for correct segregation of progeny to maintain. Derived by insertion of myo-2p::mKate2 transgene into mT1 balancer in parental strain DR1832 using CRISPR/Cas9.

Proper citation: RRID:WB-STRAIN:WBStrain00004996 Copy   


  • RRID:WB-STRAIN:WBStrain00004994

http://www.wormbase.org/db/get?name=WBStrain00004994

Source Database: WormBase (WB)
Affected Genes: WBGene00001066(dpy-4)|WBGene00006766(unc-30)
Genomic Alteration: WBGene00001066(dpy-4), WBGene00006766(unc-30)
Availability: available
Source References: EMPTY
Synonyms: unc-30(e191) dpy-4(e1166) IV; yDp1 [umnIs50] (IV;V;f).
Alternate IDs: WB-STRAIN:CGC64, CGC_CGC64
Notes: umnIs50 [myo-2p::mKate2 + NeoR, V: 1005689 (intergenic)]. Animals with the Dup are wild-type mKate2+; animals that have lost the Dup are Dpy Unc mKate2-. Maintain by picking wild-type mKate2+. Derived by insertion of myo-2p::mKate2 transgene into yDp1 duplication in parental strain TY156 using CRISPR/Cas9.

Proper citation: RRID:WB-STRAIN:WBStrain00004994 Copy   


  • RRID:WB-STRAIN:WBStrain00004993

http://www.wormbase.org/db/get?name=WBStrain00004993

Source Database: WormBase (WB)
Affected Genes: WBGene00001073(dpy-11)|WBGene00006745(unc-5)
Genomic Alteration: WBGene00001073(dpy-11), WBGene00006745(unc-5)
Availability: available
Source References: EMPTY
Synonyms: unc-5(e53)/nT1 [umnIs49] IV; dpy-11(e224)/nT1 V.
Alternate IDs: WB-STRAIN:CGC63, CGC_CGC63
Notes: umnIs49 [myo-2p::mKate2 + NeoR, V: 1005689 (intergenic)] IV. Heterozygotes are wild-type mKate2+, and segregate wild-type mKate2+, DpyUnc, Vul mKate2+ (nT1) and dead eggs. Maintain by picking wild-type mKate2+. Derived by insertion of myo-2p::mKate2 transgene into nT1 balancer in parental strain MT1000 using CRISPR/Cas9.

Proper citation: RRID:WB-STRAIN:WBStrain00004993 Copy   


  • RRID:WB-STRAIN:WBStrain00004929

http://www.wormbase.org/db/get?name=WBStrain00004929

Source Database: WormBase (WB)
Affected Genes: WBGene00001171(egl-2)|WBGene00001864(him-5)|WBGene00006830(unc-103)
Genomic Alteration: WBGene00001171(egl-2), WBGene00001864(him-5), WBGene00006830(unc-103)
Availability: available
Source References: EMPTY
Synonyms: unc-103(n1213) III; egl-2(rg4) him-5(e1490) V; rgEx173.
Alternate IDs: WB-STRAIN:CG490, CGC_CG490
Notes: rgEx173 [unc-103ep::egl-2(cDNA) + gtl-1p::CFP]. Pick animals with cyan fluorescence in their intestines. rgEx173 rescues food deprivation's ability to suppress unc-103(n1213)-induced male sex muscle seizures.

Proper citation: RRID:WB-STRAIN:WBStrain00004929 Copy   


  • RRID:WB-STRAIN:WBStrain00004928

http://www.wormbase.org/db/get?name=WBStrain00004928

Source Database: WormBase (WB)
Affected Genes: WBGene00001864(him-5)|WBGene00006779(unc-43)
Genomic Alteration: WBGene00001864(him-5), WBGene00006779(unc-43)
Availability: available
Source References: EMPTY
Synonyms: unc-43(sy574) IV; him-5(e1490) V; rgEx161.
Alternate IDs: WB-STRAIN:CG460, CGC_CG460
Notes: rgEx161[lev-11p::UNC-43g + gtl-1p::CFP]. rgEx161 rescues unc-43(sy574)-induced spicule protraction.

Proper citation: RRID:WB-STRAIN:WBStrain00004928 Copy   


  • RRID:WB-STRAIN:WBStrain00004925

http://www.wormbase.org/db/get?name=WBStrain00004925

Source Database: WormBase (WB)
Affected Genes: WBGene00001864(him-5)|WBGene00006779(unc-43)
Genomic Alteration: WBGene00001864(him-5), WBGene00006779(unc-43)
Availability: available
Source References: EMPTY
Synonyms: unc-43(sy574) IV; him-5(e1490) V.
Alternate IDs: WB-STRAIN:CG118, CGC_CG118
Notes: Males constitutively protract their spicules in the absence of mating cues.

Proper citation: RRID:WB-STRAIN:WBStrain00004925 Copy   


  • RRID:WB-STRAIN:WBStrain00004920

http://www.wormbase.org/db/get?name=WBStrain00004920

Source Database: WormBase (WB)
Availability: available
Source References: PMID:37708127
Synonyms: muEx473.
Alternate IDs: WB-STRAIN:CF3166, CGC_CF3166
Notes: muEx473 [kin-19p::kin-19::tagRFP + tph-1p::GFP]. Pick RFP+ GFP+ animals to maintain. Low transmission rate. Translational fusion of KIN-19 displaying age-dependent aggregation. Reference: David DC, et al. PLoS Biol. 2010 Aug 10;8(8):e1000450.

Proper citation: RRID:WB-STRAIN:WBStrain00004920 Copy   


  • RRID:WB-STRAIN:WBStrain00005002

    This resource has 1+ mentions.

http://www.wormbase.org/db/get?name=WBStrain00005002

Source Database: WormBase (WB)
Affected Genes: WBGene00003514(myo-2)|WBGene00004496(rps-27)|WBGene00006789(unc-54)|WBGene00021328(npr-23)
Genomic Alteration: WBGene00003514(myo-2), WBGene00004496(rps-27), WBGene00006789(unc-54), WBGene00021328(npr-23)
Availability: available
Source References: EMPTY
Synonyms: npr-23(umn5[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP]) I.
Alternate IDs: WB-STRAIN:CGC72, CGC_CGC72
Notes: Homozygous viable. Deletion of 280 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Left flanking Sequence: AAGGCGTCATCTGGAGAGAAGAACGAAgtg ; Right flanking sequence: CGGACACTTGTGCTTCACCAACTTGATCGC. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.|"Homozygous viable. Deletion of 280 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break. Left flanking Sequence: AAGGCGTCATCTGGAGAGAAGAACGAAgtg ; Right flanking sequence: CGGACACTTGTGCTTCACCAACTTGATCGC. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation."|"Made_by: RG KO Group"|"Superficially wild-type. CRISPR/Cas9 deletion of npr-23. myo-2p::GFP + NeoR cassette is still present but may be excised using LoxP sites. Left flanking sequence: cccctgcctctggctcccacaaggcgtcatctggagagaagaacgaagtg Right flanking sequence: CGGACACTTGTGCTTCACCAACTTGATCGCGTTGCTCGTATTGGTGCCGG"

Proper citation: RRID:WB-STRAIN:WBStrain00005002 Copy   


  • RRID:WB-STRAIN:WBStrain00005013

http://www.wormbase.org/db/get?name=WBStrain00005013

Source Database: WormBase (WB)
Availability: available
Source References: EMPTY
Synonyms: umnIs65 V.
Alternate IDs: WB-STRAIN:CGC84, CGC_CGC84
Notes: Made_by: Emily Lorenz-Mueller|"umnIs65 [myo-2p::mKate2 + NeoR, V:4308261 (intergenic)] V. Derived by insertion of myo-2p::mKate2 transgene into parental strain N2 using CRISPR/Cas9."

Proper citation: RRID:WB-STRAIN:WBStrain00005013 Copy   


  • RRID:WB-STRAIN:WBStrain00005094

    This resource has 10+ mentions.

http://www.wormbase.org/db/get?name=WBStrain00005094

Source Database: WormBase (WB)
Affected Genes: WBGene00006789(unc-54)
Genomic Alteration: WBGene00006789(unc-54)
Availability: available
Source References: PMID:7568134, PMID:9751195, PMID:32966472, PMID:34707479, PMID:36226991, PMID:36653384, PMID:37103980, PMID:37522064, PMID:37113386, PMID:37549461, PMID:38983916, PMID:38991033, PMID:39950089
Synonyms: dvIs2 [Punc-54::human A-beta 3-42; pRF4 (rol-6(su1006]
Alternate IDs: WB-STRAIN:CL2006, CGC_CL2006
Notes: dvIs2 [pCL12(unc-54/human Abeta peptide 1-42 minigene) + rol-6(su1006)]. Temperature-sensitive. Maintain at 15C. Adult onset paralysis and egg-laying deficiency when raised at 20C. A few animals will be paralyzed even at permissive temperatures. Received new stock from CL 8/2005.|"WBStrain provided so WBPaper00059477 paper added based on AFP_Strain data."|"WBStrain provided so WBPaper00062076 paper added based on AFP_Strain data."|"[2020-08-03T18:23:09.013Z WBPerson324] Ressurect Strain: Paper: WBPaper00002289 Genotype: dvIs2 [Punc-54::human A-beta 3-42; pRF4 (rol-6(su1006]"

Proper citation: RRID:WB-STRAIN:WBStrain00005094 Copy   


  • RRID:WB-STRAIN:WBStrain00005095

http://www.wormbase.org/db/get?name=WBStrain00005095

Source Database: WormBase (WB)
Affected Genes: WBGene00001864(him-5)
Genomic Alteration: WBGene00001864(him-5)
Availability: available
Source References: PMID:7568134
Synonyms: unc-54p::human transthyretin::rol-6 (su1006)
Alternate IDs: WB-STRAIN:CL2008, CGC_CL2008
Notes: dvIs3 [unc-54p::human transthyretin + rol-6(su1006)]. Rollers. Him. Expression of wild-type human transthyretin (TTR) in body wall muscles. Transthyretin is secreted from the muscles into the pseudocoelom and concentrates in the coelomocytes. Reference: Link CD (1995) Proc Natl Acad Sci U S A 92:9368-9372.|"Mutagen:Gamma radiation"|"[2020-08-03T20:19:01.738Z WBPerson324] Ressurect Strain: WBPaper00002289 Genotype: unc-54p::human transthyretin::rol-6 (su1006)"

Proper citation: RRID:WB-STRAIN:WBStrain00005095 Copy   


  • RRID:WB-STRAIN:WBStrain00005007

http://www.wormbase.org/db/get?name=WBStrain00005007

Source Database: WormBase (WB)
Affected Genes: WBGene00003514(myo-2)|WBGene00004496(rps-27)|WBGene00006789(unc-54)
Genomic Alteration: WBGene00003514(myo-2), WBGene00004496(rps-27), WBGene00006789(unc-54)
Availability: available
Source References: EMPTY
Synonyms: C04C3.6(umn8[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP]) IV.
Alternate IDs: WB-STRAIN:CGC78, CGC_CGC78
Notes: Homozygous viable. Deletion of 1123 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Left flanking Sequence: aaaaatcaactatttttaatgaaaatttca ; Right flanking sequence: TGGTCACTTTACCTGCGTTGATATTCATGT. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.|"Homozygous viable. Deletion of 1123 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break. Left flanking Sequence: aaaaatcaactatttttaatgaaaatttca ; Right flanking sequence: TGGTCACTTTACCTGCGTTGATATTCATGT. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation."|"Made_by: RG KO Group"|"Superficially wild-type. CRISPR/Cas9 deletion of C04C3.6. myo-2p::GFP + NeoR cassette is still present but may be excised using LoxP sites. Left flanking sequence: ttgaaaatttgaaatttgaaaaaaatcaactatttttaatgaaaatttca Right flanking sequence: TGGTCACTTTACCTGCGTTGATATTCATGTTCATCGTGCTTCGAAAGTAC"

Proper citation: RRID:WB-STRAIN:WBStrain00005007 Copy   


  • RRID:WB-STRAIN:WBStrain00005008

http://www.wormbase.org/db/get?name=WBStrain00005008

Source Database: WormBase (WB)
Affected Genes: WBGene00001070(dpy-8)|WBGene00003056(lon-2)|WBGene00006743(unc-3)
Genomic Alteration: WBGene00001070(dpy-8), WBGene00003056(lon-2), WBGene00006743(unc-3)
Availability: available
Source References: EMPTY
Synonyms: +/szT1 [lon-2(e678) umnIs61] I; dpy-8(e1321) unc-3(e151)/szT1 X.
Alternate IDs: WB-STRAIN:CGC79, CGC_CGC79
Notes: umnIs61 [myo-2p::mKate2 + NeoR, X: 15420938 (intergenic)] I. Heterozygotes are wild-type mKate2+, and segregate wild-type mKate2+, DpyUnc non-mKate2, dead eggs and mKate2+ Lon males. Maintain by picking wild-type mKate2+. Derived by insertion of myo-2p::mKate2 transgene into szT1 balancer in parental strain AF1 using CRISPR/Cas9.

Proper citation: RRID:WB-STRAIN:WBStrain00005008 Copy   



Can't find your Organism?

We recommend that you click next to the search bar to check some helpful tips on searches and refine your search firstly. If you want to find a specific organism, it's easier to enter an RRID or a Catalog Number to search. You can refine the search results using Facets on the left side of the search results page. If you are on the table view, you can also search in a specific column by clicking the column title and enter the keywords.

If you still could not find your organism in the search results, please help us by registering it into the system — it's easy. Organisms identifiers are registered through multiple sources depending on the species:

Can't find the RRID you're searching for? X
  1. Neuroscience Information Framework Resources

    Welcome to the NIF Resources search. From here you can search through a compilation of resources used by NIF and see how data is organized within our community.

  2. Navigation

    You are currently on the Community Resources tab looking through categories and sources that NIF has compiled. You can navigate through those categories from here or change to a different tab to execute your search through. Each tab gives a different perspective on data.

  3. Logging in and Registering

    If you have an account on NIF then you can log in from here to get additional features in NIF such as Collections, Saved Searches, and managing Resources.

  4. Searching

    Here is the search term that is being executed, you can type in anything you want to search for. Some tips to help searching:

    1. Use quotes around phrases you want to match exactly
    2. You can manually AND and OR terms to change how we search between words
    3. You can add "-" to terms to make sure no results return with that term in them (ex. Cerebellum -CA1)
    4. You can add "+" to terms to require they be in the data
    5. Using autocomplete specifies which branch of our semantics you with to search and can help refine your search
  5. Save Your Search

    You can save any searches you perform for quick access to later from here.

  6. Query Expansion

    We recognized your search term and included synonyms and inferred terms along side your term to help get the data you are looking for.

  7. Collections

    If you are logged into NIF you can add data records to your collections to create custom spreadsheets across multiple sources of data.

  8. Sources

    Here are the sources that were queried against in your search that you can investigate further.

  9. Categories

    Here are the categories present within NIF that you can filter your data on

  10. Subcategories

    Here are the subcategories present within this category that you can filter your data on

  11. Further Questions

    If you have any further questions please check out our FAQs Page to ask questions and see our tutorials. Click this button to view this tutorial again.

X