Searching the RRID Resource Information Network
Are you sure you want to leave this community? Leaving the community will revoke any permissions you have been granted in this community.
Integrated Animals is a virtual database currently indexing available animal strains and mutants from: AGSC (Ambystoma), BCBC (mice), BDSC (flies), European Xenopus Resource Center (frog), The National Xenopus Resource (frog), Xenopus Express (frog), CWRU Cystic Fibrosis Mouse Models (mice), DGGR (flies), FlyBase (flies), IMSR (mice), MGI (mice), MMRRC (mice), NSRRC (pig), RGD (rats), Sperm Stem Cell Libraries for Biological Research (rats), Tetrahymena Stock Center (Tetrahymena), WormBase (worms), XGSC (Xiphophorus), ZFIN (zebrafish), and ZIRC (zebrafish). Note, the IMSR data is linked, but users may need to re-execute the search if the top mouse is not returned properly.
Note: BCBC is no longer in service, so the links may not be functional.
| Organism Name | Proper Citation | Species | Synonyms |
Notes |
Phenotype | Affected Gene | ||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
|
C30E1.9(gk3854[loxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + loxP]) X. Resource Report Resource Website |
RRID:WB-STRAIN:WBStrain00051107 | Caenorhabditis elegans | C30E1.9(gk3854[loxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + loxP]) X. | Homozygous viable. Deletion of 11852 bp with Calarco/Colaiacovo selection cassette conferring myo-2::GFP and G418 resistance inserted at break. Left flanking sequence: TGTTCCCTCACCCTTACTTTCGAATTCCCT. Right flanking sequence: TGGTTGTTTAATATGGTTATTCTTAAGGTA. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.|"Made_by: Vancouver KO Group" | WBGene00003514(myo-2)|WBGene00004496(rps-27)|WBGene00006789(unc-54) | WBGene00003514(myo-2), WBGene00004496(rps-27), WBGene00006789(unc-54) | WB-STRAIN:WBStrain00051107 | WormBase (WB) | WB | unknown | 2026-09-12 11:20:47 | 0 | ||||
|
VC40090 Resource Report Resource Website |
RRID:WB-STRAIN:WBStrain00039075 | Caenorhabditis elegans | Whole-genome sequenced strain. | Homozygous viable. Deletion of 1570 bp with Calarco/Colaiacovo selection cassette conferring myo-2::GFP and G418 resistance inserted at break. Left flanking sequence: TCTATATTGTTCTTCACGCCAGGTCTACAA; Right flanking sequence: GGAGGTACCACAACGGAGGTAAATTTGAAA. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.|"Made_by: Vancouver KO Group"|"Million Mutation Project strain. This strain was isolated after EMS+ENU mutagenesis of VC2010, propagated clonally through F10 to drive mutations to homozygosity, and subjected to whole-genome sequencing. It is homozygous for a large number of mutations determined from sequence data. It may also carry large copy number variations that are not homozygous. Alleles numbered between gk100000 and gk962522 are homozygous; those numbered from gk962523 up should be assumed to be non-homozygous. A graphical representation of these large copy number differences can be seen in the Plot section for each strain on the MMP web site ( URL: genome.sfu.ca/mmp/)."|"This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use." | WBGene00003514(myo-2)|WBGene00004496(rps-27)|WBGene00006789(unc-54) | WBGene00003514(myo-2), WBGene00004496(rps-27), WBGene00006789(unc-54) | WB-STRAIN:WBStrain00039075 | WormBase (WB) | WB | available | WB-STRAIN:VC40090, CGC_VC40090 | 2026-09-12 11:18:08 | 0 | |||
|
VC40060 Resource Report Resource Website |
RRID:WB-STRAIN:WBStrain00039046 | Caenorhabditis elegans | Whole-genome sequenced strain. | Homozygous viable. Deletion of 1917 bp with Calarco/Colaiacovo selection cassette conferring myo-2::GFP and G418 resistance inserted at break. Left flanking sequence: TTGAAATTGGAGAGAGCAGTGGACAGAGGT; Right flanking sequence: TGAGGGGAATACGCCAGGTTTCGCCAGGAA. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.|"Made_by: Vancouver KO Group"|"Million Mutation Project strain. This strain was isolated after EMS+ENU mutagenesis of VC2010, propagated clonally through F10 to drive mutations to homozygosity, and subjected to whole-genome sequencing. It is homozygous for a large number of mutations determined from sequence data. It may also carry large copy number variations that are not homozygous. Alleles numbered between gk100000 and gk962522 are homozygous; those numbered from gk962523 up should be assumed to be non-homozygous. A graphical representation of these large copy number differences can be seen in the Plot section for each strain on the MMP web site ( URL: genome.sfu.ca/mmp/)."|"This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use." | WBGene00003514(myo-2)|WBGene00004496(rps-27)|WBGene00006789(unc-54)|WBGene00017901(siss-1) | WBGene00003514(myo-2), WBGene00004496(rps-27), WBGene00006789(unc-54), WBGene00017901(siss-1) | WB-STRAIN:WBStrain00039046 | WormBase (WB) | WB | available | WB-STRAIN:VC40060, CGC_VC40060 | 2026-09-12 11:18:08 | 0 | |||
|
arTi443 [rps-27p::TIR1(F79G)(lox2272-flexon-lox2272)::unc-54 3'UTR + HygroR] V. Resource Report Resource Website |
RRID:WB-STRAIN:WBStrain00060022 | Caenorhabditis elegans | arTi443 [rps-27p::TIR1(F79G)(lox2272-flexon-lox2272)::unc-54 3'UTR + HygroR] V. | arTi443 [rps-27p::TIR1(F79G)(lox2272-flexon-lox2272)::unc-54 3'UTR + HygroR] V (+21.99). The first intron of TIR1(F79G) was replaced with a Flexon containing two lox2272 sites. TIR1(F79G) is expressed at a high level in lineages where Cre is expressed with a second transgene. Reference: Wittes J & Greenwald I. (2024). New Flexon-based reagents for tissue-specific Auxin-Inducible Degradation and for characterizing Cre and Flp drivers in C. elegans. microPublication Biology. 10.17912/micropub.biology.001315.|"Made_by: Julia Wittes"|"[2024-08-17T00:33:18.351Z WBPerson712] New Strain: WBPaper00067148 GS9820 arTi443" | WBGene00004496(rps-27)|WBGene00006789(unc-54) | WBGene00004496(rps-27), WBGene00006789(unc-54) | WB-STRAIN:WBStrain00060022 | WormBase (WB) | WB | unknown | PMID:39228994 | 2026-09-12 11:22:46 | 0 | |||
|
rps-29(ve992[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP])/sC1(s2023) [dpy-1(s2170) umnIs41] III. Resource Report Resource Website |
RRID:WB-STRAIN:WBStrain00063081 | Caenorhabditis elegans | rps-29(ve992[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP])/sC1(s2023) [dpy-1(s2170) umnIs41] III. | Made_by: RG KO Group|"umnIs41 [myo-2p::mKate2 + NeoR, III: 518034 (intergenic)] III. Larval arrest. Deletion of 754 with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Heterozygotes are wild-type GFP+ mKate2+, and segregate wild-type GFP+ mKate2+, GFP+ non-mKate2 arrested larvae (ve992 homozygotes), Dpy non-GFP mKate2+ (sC1 homozygotes). Maintain by picking wild-type GFP+ mKate2+. Left flanking Sequence: caccgtcttcttgttttccgcttttttcct; Right flanking sequence: gttaacttcatgtcttcaatcaataaattg. rps-29 crRNA A: ttcgaaaaagctgtaaacgg; rps-29 crRNA B: aataacaagatttgacgagg. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation." | WBGene00001063(dpy-1)|WBGene00003514(myo-2)|WBGene00004496(rps-27)|WBGene00004498(rps-29)|WBGene00006789(unc-54) | WBGene00001063(dpy-1), WBGene00003514(myo-2), WBGene00004496(rps-27), WBGene00004498(rps-29), WBGene00006789(unc-54) | WB-STRAIN:WBStrain00063081 | WormBase (WB) | WB | unknown | 2026-09-12 11:23:25 | 0 | ||||
|
K02D10.4(ve995[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP]) III. Resource Report Resource Website |
RRID:WB-STRAIN:WBStrain00063082 | Caenorhabditis elegans | K02D10.4(ve995[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP]) III. | Homozygous viable. Deletion of 1717 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Left flanking Sequence: tgcgctccattggcaaatgaaaacgctccg ; Right flanking sequence: TGGAATTATAAGCAATTTTTCAAAAATCTA. K02D10.4 sgRNA A: cgagaccgaactgttgaggg; K02D10.4 sgRNA B: ATGATGAACACGATGACATC. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.|"Made_by: RG KO Group" | WBGene00003514(myo-2)|WBGene00004496(rps-27)|WBGene00006789(unc-54) | WBGene00003514(myo-2), WBGene00004496(rps-27), WBGene00006789(unc-54) | WB-STRAIN:WBStrain00063082 | WormBase (WB) | WB | unknown | 2026-09-12 11:23:25 | 0 | ||||
|
egrh-3(ve983[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP]) IV. Resource Report Resource Website |
RRID:WB-STRAIN:WBStrain00063074 | Caenorhabditis elegans | egrh-3(ve983[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP]) IV. | Homozygous viable. Deletion of 8336 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Left flanking Sequence: GAAGCTTGTGATGCTCCACCACCAGCTCCA ; Right flanking sequence: tggcctagaaaaaagttaggccaccaataa. egrh-3 crRNA A: ACGACATTTAAGCTTCAGGG; egrh-3 crRNA B: CACGCGattttctgatacgg. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.|"Made_by: RG KO Group" | WBGene00003514(myo-2)|WBGene00004496(rps-27)|WBGene00006789(unc-54)|WBGene00044651(egrh-3) | WBGene00003514(myo-2), WBGene00004496(rps-27), WBGene00006789(unc-54), WBGene00044651(egrh-3) | WB-STRAIN:WBStrain00063074 | WormBase (WB) | WB | unknown | 2026-09-12 11:23:25 | 0 | ||||
|
+/mT1 [umnIs52] II; eftu-2(ve984[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP])/mT1 [dpy-10(e128)] III. Resource Report Resource Website |
RRID:WB-STRAIN:WBStrain00063075 | Caenorhabditis elegans | +/mT1 [umnIs52] II; eftu-2(ve984[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP])/mT1 [dpy-10(e128)] III. | Made_by: RG KO Group|"umnIs52 [myo-2p::mKate2 + NeoR, III: 8856215 (intergenic)] II. Larval arrest. Deletion of 2360 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Heterozygotes are wild-type GFP+ mKate2+, and segregate wild-type GFP+ mKate2+ heterozygotes, GFP+ non-mKate2 arrested larvae (ve984 homozygotes), sterile Dpy non-GFP mKate2+ (mT1 homozygotes), and dead eggs (aneuploids). Maintain by picking wild-type GFP+ mKate2+ and check for correct segregation of progeny. Note: some, but not all balanced heterozygotes display vulva phenotypes such as blips, explode at vulva, and/or egl. Left flanking Sequence: TGTTCTTCATGAAGATAAAAAGTACTATGC; Right flanking sequence: TGGAGGTCAGATGATCCCAACTGCACGCCG. eftu-2 sgRNA #1: TACAGCTCTCGAAGTATACG; eftu-2 sgRNA #2: ACAGAACCACTTTATCGAGG. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation." | WBGene00001072(dpy-10)|WBGene00001166(eftu-2)|WBGene00003514(myo-2)|WBGene00004496(rps-27)|WBGene00006789(unc-54) | WBGene00001072(dpy-10), WBGene00001166(eftu-2), WBGene00003514(myo-2), WBGene00004496(rps-27), WBGene00006789(unc-54) | WB-STRAIN:WBStrain00063075 | WormBase (WB) | WB | unknown | 2026-09-12 11:23:25 | 0 | ||||
|
col-123(ve980[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP]) IV. Resource Report Resource Website |
RRID:WB-STRAIN:WBStrain00063072 | Caenorhabditis elegans | col-123(ve980[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP]) IV. | Homozygous viable. Deletion of 1079 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. The indel of col-123 resides within an intron of catp-6. It is not known if ve980 affects catp-6 expression or function. Left flanking Sequence: ggaaatgatgggaatattttcagagttcct ; Right flanking sequence: AGGTGGAGGCGGCGGAGGCGGAGAATACAA. col-123 sgRNA A: ATGACACTTGCATtctatac; col-123 sgRNA B: TCTCATGGTGGTTCATCTGG. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.|"Made_by: RG KO Group" | WBGene00000697(col-123)|WBGene00003514(myo-2)|WBGene00004496(rps-27)|WBGene00006789(unc-54) | WBGene00000697(col-123), WBGene00003514(myo-2), WBGene00004496(rps-27), WBGene00006789(unc-54) | WB-STRAIN:WBStrain00063072 | WormBase (WB) | WB | unknown | 2026-09-12 11:23:25 | 0 | ||||
|
rps-17(ve989[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP])/hT1 [umnIs58] I; +/hT1 [unc-42(e270)] V. Resource Report Resource Website |
RRID:WB-STRAIN:WBStrain00063079 | Caenorhabditis elegans | rps-17(ve989[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP])/hT1 [umnIs58] I; +/hT1 [unc-42(e270)] V. | Made_by: RG KO Group|"umnIs58 [myo-2p::mKate2 + NeoR, V: 1005689 (intergenic)] V. Sterile. Deletion of 459 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Heterozygotes are wild-type GFP+ mKate2+ heterozygotes, and segregate wild-type GFP+ mKate2+, GFP+ non-mKate2 ve989 homozygotes (most are inviable, some reach adulthood and are sickly, sterile with a protruding vulva, some may produce a small brood), non-GFP mKate2+ arrested larvae (hT1 homozygotes), and dead eggs (aneuploids). Maintain by picking wild-type GFP+ and mKate2+. Left flanking Sequence: acttacAGCGGCCTTGAGCATGTCGCTGGT; Right flanking sequence: aggtcgaatgagaaaaaaattaattgatat. rps-17 crRNA A: ATCAGTGTCAACCTTGATGG; rps-17 crRNA B: gcgcaacgtaatagatgaac. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation." | WBGene00003514(myo-2)|WBGene00004486(rps-17)|WBGene00004496(rps-27)|WBGene00006778(unc-42)|WBGene00006789(unc-54) | WBGene00003514(myo-2), WBGene00004486(rps-17), WBGene00004496(rps-27), WBGene00006778(unc-42), WBGene00006789(unc-54) | WB-STRAIN:WBStrain00063079 | WormBase (WB) | WB | unknown | 2026-09-12 11:23:25 | 0 | ||||
|
rps-15A(ve986[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP])/sC1(s2023) [dpy-1(s2170)umnIs41] III. Resource Report Resource Website |
RRID:WB-STRAIN:WBStrain00063076 | Caenorhabditis elegans | rps-15A(ve986[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP])/sC1(s2023) [dpy-1(s2170)umnIs41] III. | Made_by: RG KO Group|"umnIs41 [myo-2p::mKate2 + NeoR, III: 518034 (intergenic)] III. Early larval arrest. Deletion of 598 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Heterozygotes are wild-type GFP+ mKate2+, and segregate wild-type GFP+ mKate2+, GFP+ non-mKate2 arrested larvae (ve986 homozygotes), Dpy non-GFP mKate2+ (sC1 homozygotes). Maintain by picking wild-type GFP+ mKate2+. Other names: CELE_F53A3.3, uS8, rps-22. Left flanking Sequence: ATGAACGTCCTCGCCGATGCGCTCAACGCC; Right flanking sequence: CACGAGGAGGCCAGAAGAAAGCATTTGGGA. rps-22 crRNA A: ATCAACAACGCCGAGAAGCG; rps-22 crRNA B: ATCCATGATTCCGGCGGAGG. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation." | WBGene00001063(dpy-1)|WBGene00003514(myo-2)|WBGene00004484(rps-15)|WBGene00004496(rps-27)|WBGene00006789(unc-54) | WBGene00001063(dpy-1), WBGene00003514(myo-2), WBGene00004484(rps-15), WBGene00004496(rps-27), WBGene00006789(unc-54) | WB-STRAIN:WBStrain00063076 | WormBase (WB) | WB | unknown | 2026-09-12 11:23:25 | 0 | ||||
|
dhs-20(ve987[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP]) V. Resource Report Resource Website |
RRID:WB-STRAIN:WBStrain00063077 | Caenorhabditis elegans | dhs-20(ve987[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP]) V. | Homozygous viable. Deletion of 1097 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Left flanking Sequence: TTTTTTGGGATATTATTTTTAAAAAACCCT ; Right flanking sequence: ATTGATAAGGTTTTTTTGTTCTTGATTCTT. dhs-20 sgRNA A: GAGATTGTTAAAGGGTGTCC ; dhs-20 sgRNA B: TGGGTCGACCTTGAACACGC. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.|"Made_by: RG KO Group" | WBGene00000983(dhs-20)|WBGene00003514(myo-2)|WBGene00004496(rps-27)|WBGene00006789(unc-54) | WBGene00000983(dhs-20), WBGene00003514(myo-2), WBGene00004496(rps-27), WBGene00006789(unc-54) | WB-STRAIN:WBStrain00063077 | WormBase (WB) | WB | unknown | 2026-09-12 11:23:25 | 0 | ||||
|
col-14(ve965[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP]) IV. Resource Report Resource Website |
RRID:WB-STRAIN:WBStrain00063063 | Caenorhabditis elegans | col-14(ve965[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP]) IV. | Homozygous viable. Deletion of 1019 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Left flanking Sequence: TTATATTCAAACTTTGGAATCTCAAGTTCA ; Right flanking sequence: aggataattttgatttgtatacttacgttt. Note that col-14 resides in the 6th intron of C46A5.4 and it is not known whether this indel alters its expression. col-14 sgRNA A: ACTTGATCTTGAATTCTGCC; col-14 sgRNA B: tgtttgtatcgaaaatctgt. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.|"Made_by: RG KO Group" | WBGene00000603(col-14)|WBGene00003514(myo-2)|WBGene00004496(rps-27)|WBGene00006789(unc-54) | WBGene00000603(col-14), WBGene00003514(myo-2), WBGene00004496(rps-27), WBGene00006789(unc-54) | WB-STRAIN:WBStrain00063063 | WormBase (WB) | WB | unknown | 2026-09-12 11:23:25 | 0 | ||||
|
F40G9.12(ve963[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP]) III. Resource Report Resource Website |
RRID:WB-STRAIN:WBStrain00063061 | Caenorhabditis elegans | F40G9.12(ve963[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP]) III. | Homozygous viable. Deletion of 511 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Left flanking Sequence: ACTTTATGTATTGCGAGTGCAGAAATAATA ; Right flanking sequence: TGAGGATTGTAAGGAGCACGAGTGTAAAGC. F40G9.12 sgRNA A: TATTTCAACGAACACGGAGA; F40G9.12 sgRNA B: CAGACACTTTTACCACAGGA. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.|"Made_by: RG KO Group" | WBGene00003514(myo-2)|WBGene00004496(rps-27)|WBGene00006789(unc-54) | WBGene00003514(myo-2), WBGene00004496(rps-27), WBGene00006789(unc-54) | WB-STRAIN:WBStrain00063061 | WormBase (WB) | WB | unknown | 2026-09-12 11:23:25 | 0 | ||||
|
enpp-1(ve964[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP]) V. Resource Report Resource Website |
RRID:WB-STRAIN:WBStrain00063062 | Caenorhabditis elegans | enpp-1(ve964[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP]) V. | Homozygous viable. Deletion of 4885 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Left flanking Sequence: ttttaaaattcttctaatatttgctagccg ; Right flanking sequence: tatcgggtcattcaatctttgcaggatttc. enpp-1 sgRNA A: acggtgagaacgatagagaa; enpp-1 sgRNA B: tgaaacaagtggagtgaggt. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.|"Made_by: RG KO Group" | WBGene00003514(myo-2)|WBGene00004496(rps-27)|WBGene00006789(unc-54)|WBGene00007753(enpp-1) | WBGene00003514(myo-2), WBGene00004496(rps-27), WBGene00006789(unc-54), WBGene00007753(enpp-1) | WB-STRAIN:WBStrain00063062 | WormBase (WB) | WB | unknown | 2026-09-12 11:23:25 | 0 | ||||
|
eif-2Bbeta(ve975[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP])/hIn1 [umnIs78] I. Resource Report Resource Website |
RRID:WB-STRAIN:WBStrain00063069 | Caenorhabditis elegans | eif-2Bbeta(ve975[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP])/hIn1 [umnIs78] I. | Made_by: RG KO Group|"umnIs78 [myo-2p::mKate2 + NeoR, I: 12541645 (intergenic)] I. Larval arrest. Deletion of 1777 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Heterozygotes are wild-type GFP+ mKate2+, and segregate wild-type GFP+ mKate2+, GFP+ non-mKate2 arrested larvae (ve975 homozygotes), and viable non-GFP mKate2+ animals (hIn1[umnIs78] homozygotes). Maintain by picking wild-type GFP+mKate2+. Left flanking Sequence: acgaaaaaagacccagaaaaaatggagaaa; Right flanking sequence: ATATTAATAATAATGAGCTCCGATCGCTCG. eif-2Bbeta crRNA A: aaCGGGGGGTACAAGTTATG; eif-2Bbeta crRNA B: CGGCTTAATGATCACGAAAT. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation." | WBGene00003514(myo-2)|WBGene00004496(rps-27)|WBGene00006789(unc-54) | WBGene00003514(myo-2), WBGene00004496(rps-27), WBGene00006789(unc-54) | WB-STRAIN:WBStrain00063069 | WormBase (WB) | WB | unknown | 2026-09-12 11:23:25 | 0 | ||||
|
B0281.3(ve954[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP]) II. Resource Report Resource Website |
RRID:WB-STRAIN:WBStrain00063053 | Caenorhabditis elegans | B0281.3(ve954[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP]) II. | Homozygous viable. Deletion of 800 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Left flanking Sequence: TATTCCAAAATGCAAGGCTCACCCGTATAA ; Right flanking sequence: ACCCATATGCAGCTATGAAACAACTGGATG. B0281.3 sgRNA A: TCTGGCTGAATTTTTCTGTG; B0281.3 sgRNA B: CTGACTCCCCACTACTCCTG. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.|"Made_by: RG KO Group" | WBGene00003514(myo-2)|WBGene00004496(rps-27)|WBGene00006789(unc-54) | WBGene00003514(myo-2), WBGene00004496(rps-27), WBGene00006789(unc-54) | WB-STRAIN:WBStrain00063053 | WormBase (WB) | WB | unknown | 2026-09-12 11:23:24 | 0 | ||||
|
gst-1(ve951[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP]) III. Resource Report Resource Website |
RRID:WB-STRAIN:WBStrain00063051 | Caenorhabditis elegans | gst-1(ve951[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP]) III. | Homozygous viable. Deletion of 698 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Left flanking Sequence: CACTCAACTTCGTTCAATATGACCCTCAAG ; Right flanking sequence: TGGAAATGGAAAACAATAAGCTAATTCAAT. gst-1 sgRNA A: CTCACGTACTTCGACATCCA; gst-1 sgRNA B: GCTATCAACCCACCAGTAAA. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.|"Made_by: RG KO Group" | WBGene00001749(gst-1)|WBGene00003514(myo-2)|WBGene00004496(rps-27)|WBGene00006789(unc-54) | WBGene00001749(gst-1), WBGene00003514(myo-2), WBGene00004496(rps-27), WBGene00006789(unc-54) | WB-STRAIN:WBStrain00063051 | WormBase (WB) | WB | unknown | 2026-09-12 11:23:24 | 0 | ||||
|
ncs-7(ve956[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP]) X. Resource Report Resource Website |
RRID:WB-STRAIN:WBStrain00063055 | Caenorhabditis elegans | ncs-7(ve956[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP]) X. | Homozygous viable. Deletion of 4799 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Left flanking Sequence: CGAGAGCTTGAGGTGGTCCCGCCGCCGCCC ; Right flanking sequence: TGGGCTTGAAATGGGCAATTCGGAATTCCA. ncs-7 sgRNA A: GATGCCCATGTCATAGTCGG; ncs-7 sgRNA B: CTTTGTTGTGTGTACTGGGT. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.|"Made_by: RG KO Group" | WBGene00003514(myo-2)|WBGene00004496(rps-27)|WBGene00006789(unc-54)|WBGene00015867(ncs-7) | WBGene00003514(myo-2), WBGene00004496(rps-27), WBGene00006789(unc-54), WBGene00015867(ncs-7) | WB-STRAIN:WBStrain00063055 | WormBase (WB) | WB | unknown | 2026-09-12 11:23:24 | 0 | ||||
|
gln-3(ve959[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP]) IV. Resource Report Resource Website |
RRID:WB-STRAIN:WBStrain00063058 | Caenorhabditis elegans | gln-3(ve959[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP]) IV. | Homozygous viable. Deletion of 2417 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Left flanking Sequence: GCGGTCTCGTGGAGTCCGGTCAAACGACGC ; Right flanking sequence: ACCTGCTTGTCGGTGGCGAATTGACTGCGG. gln-3 sgRNA A: TCGTTGTCTTTTCCACCGTG; gln-3 sgRNA B: CCTGCAAAAGTTCCTGAACT. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.|"Made_by: RG KO Group" | WBGene00001604(gln-3)|WBGene00003514(myo-2)|WBGene00004496(rps-27)|WBGene00006789(unc-54) | WBGene00001604(gln-3), WBGene00003514(myo-2), WBGene00004496(rps-27), WBGene00006789(unc-54) | WB-STRAIN:WBStrain00063058 | WormBase (WB) | WB | unknown | 2026-09-12 11:23:25 | 0 |
Can't find your Organism?
We recommend that you click next to the search bar to check some helpful tips on searches and refine your search firstly. If you want to find a specific organism, it's easier to enter an RRID or a Catalog Number to search. You can refine the search results using Facets on the left side of the search results page. If you are on the table view, you can also search in a specific column by clicking the column title and enter the keywords.
If you still could not find your organism in the search results, please help us by registering it into the system — it's easy. Organisms identifiers are registered through multiple sources depending on the species:
Welcome to the NIF Resources search. From here you can search through a compilation of resources used by NIF and see how data is organized within our community.
You are currently on the Community Resources tab looking through categories and sources that NIF has compiled. You can navigate through those categories from here or change to a different tab to execute your search through. Each tab gives a different perspective on data.
If you have an account on NIF then you can log in from here to get additional features in NIF such as Collections, Saved Searches, and managing Resources.
Here is the search term that is being executed, you can type in anything you want to search for. Some tips to help searching:
If you are logged into NIF you can add data records to your collections to create custom spreadsheets across multiple sources of data.
Here are the facets that you can filter the data by.
If you have any further questions please check out our FAQs Page to ask questions and see our tutorials. Click this button to view this tutorial again.
Welcome to the Neuroscience Information Framework Project, designed to serve the biomedical research community. NIF maintains the largest searchable collection of neuroscience data, the largest catalog of biomedical resources, and the largest ontology for neuroscience on the web. We welcome all feedback and suggestions and are actively looking for resource providers to make their resources accessible through NIF. Learn about the tools available to help you share your data and discover a dynamic inventory of Web-based neuroscience resources.
