Searching the RRID Resource Information Network
Are you sure you want to leave this community? Leaving the community will revoke any permissions you have been granted in this community.
Integrated Animals is a virtual database currently indexing available animal strains and mutants from: AGSC (Ambystoma), BCBC (mice), BDSC (flies), European Xenopus Resource Center (frog), The National Xenopus Resource (frog), Xenopus Express (frog), CWRU Cystic Fibrosis Mouse Models (mice), DGGR (flies), FlyBase (flies), IMSR (mice), MGI (mice), MMRRC (mice), NSRRC (pig), RGD (rats), Sperm Stem Cell Libraries for Biological Research (rats), Tetrahymena Stock Center (Tetrahymena), WormBase (worms), XGSC (Xiphophorus), ZFIN (zebrafish), and ZIRC (zebrafish). Note, the IMSR data is linked, but users may need to re-execute the search if the top mouse is not returned properly.
Note: BCBC is no longer in service, so the links may not be functional.
| Organism Name | Proper Citation | Species | Synonyms |
Notes |
Phenotype | Affected Gene | ||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
|
hpIs596; hpIs268. Resource Report Resource Website |
RRID:WB-STRAIN:WBStrain00055699 | Caenorhabditis elegans | hpIs596; hpIs268. | hpIs596 [acr-2(s)p::Chrimson::wCherry + lin-15(+)]. hpIs268 [unc-25p::GCaMP3si::SL2 wCherry + lin-15(+)]. Unc (linked to hpIs596). Green and red fluorescence in D-motor neurons. Very weak red fluorescence in A and B motorneurons. Reference: Lim MA, et al. eLife 2016;5:e19887. doi: 10.7554/eLife.19887. PMID: 27855782. | WB-STRAIN:WBStrain00055699 | WormBase (WB) | WB | unknown | 2026-08-01 10:24:49 | 0 | ||||||
|
hpIs615; hpIs365. Resource Report Resource Website |
RRID:WB-STRAIN:WBStrain00055732 | Caenorhabditis elegans | hpIs615; hpIs365. | hpIs615 [acr-2(s)p::Arch::wCherry + lin-15(+)]. hpIs365 [unc-25p::GCaMP3::wCherry + lin-15(+)]. RFP expression in motor neurons. A and B motor neurons are inhibited and body relaxes upon illumination with green light. Reference: Lu Y, et al. 2022. Current Biology (In Press). | WB-STRAIN:WBStrain00055732 | WormBase (WB) | WB | unknown | 2026-08-01 10:24:49 | 0 | ||||||
|
fjSi1 II; csr-1(fj54) IV. Resource Report Resource Website |
RRID:WB-STRAIN:WBStrain00055735 | Caenorhabditis elegans | fjSi1 II; csr-1(fj54) IV. | fjSi1 [2FLAG::csr-1 + Cbr-unc-119(+)] II. Single-copy insertion in the MosSCI locus ttTi5605 (LG II). The 2FLAG::csr-1 transgene was designed to express proteins with a double FLAG tag instead of the N169 of CSR-1a and N6 of CSR-1b. The linker sequence between the two FLAG tags has a NotI site. The insertion can be checked by PCR with the following primers: CACACTCGATTCTACGCCAA (at the 3'-side of csr-1) and ATCGGGAGGCGAACCTAACTG (near ttTi5605 on LG II). Reference: Tabara H, et al. (2023) A small RNA system ensures accurate homologous pairing and unpaired silencing of meiotic chromosomes. EMBO J, e105002. | WBGene00017641(csr-1) | WBGene00017641(csr-1) | WB-STRAIN:WBStrain00055735 | WormBase (WB) | WB | unknown | 2026-08-01 10:24:49 | 0 | ||||
|
unc-25(e156) III; hpIs673; ljIs131. Resource Report Resource Website |
RRID:WB-STRAIN:WBStrain00055734 | Caenorhabditis elegans | unc-25(e156) III; hpIs673; ljIs131. | hpIs673 [rgef-1p::Chrimson::UrSL2::wCherry + lin-15(+)]. ljIs131 [myo-3p::GCaMP3::UrSL2::tagRFP-T]. Shrinker. All neurons are marked with red fluorescence. Pan-neuronal activation and muscle contraction upon green light illumination with ATR. Reference: Lu Y, et al. 2022. Current Biology (In Press). | WBGene00006762(unc-25) | WBGene00006762(unc-25) | WB-STRAIN:WBStrain00055734 | WormBase (WB) | WB | unknown | 2026-08-01 10:24:47 | 0 | ||||
|
hpIs740. Resource Report Resource Website |
RRID:WB-STRAIN:WBStrain00055685 | Caenorhabditis elegans | hpIs740. | hpIs740 [twk-40(s)p::GCaMP6s::wScarlet + lin-15(+)]. GCaMP and RFP expression in AVA, AVB, AVE and DVA. Reference: Lu Y, et al. 2022. Current Biology (In Press). | WB-STRAIN:WBStrain00055685 | WormBase (WB) | WB | unknown | 2026-08-01 10:24:47 | 0 | ||||||
|
hpIs758. Resource Report Resource Website |
RRID:WB-STRAIN:WBStrain00055684 | Caenorhabditis elegans | hpIs758. | hpIs758 [rig-3p::LoxP::eBFP::LoxP::Chrimson::wCherry + twk-40(s)p::Cre + myo-2p::wCherry]. Pick animals with red fluorescence to maintain. Weak myo-2 and AVA Cherry expression. hpIs758 is a spontaneous insertion of hpEx4080. Reference: Lu Y, et al. 2022. Current Biology (In Press). | WB-STRAIN:WBStrain00055684 | WormBase (WB) | WB | unknown | PMID:38598630 | 2026-08-01 10:24:48 | 0 | |||||
|
hpIs717; ljIs131. Resource Report Resource Website |
RRID:WB-STRAIN:WBStrain00055687 | Caenorhabditis elegans | hpIs717; ljIs131. | hpIs717 [acr-2(s)p::LoxP::eBFP::LoxP::Chrimson::wCherry + unc-17p::Cre + lin-15(+)]. ljIs131 [myo-3p::GCaMP3::UrSL2::tagRFP-T]. Red fluorescence in motor neurons. Reference: Lu Y, et al. 2022. Current Biology (In Press). | WB-STRAIN:WBStrain00055687 | WormBase (WB) | WB | unknown | 2026-08-01 10:24:48 | 0 | ||||||
|
unc-25(e156) III; ljIs131; hpIs758. Resource Report Resource Website |
RRID:WB-STRAIN:WBStrain00055686 | Caenorhabditis elegans | unc-25(e156) III; ljIs131; hpIs758. | ljIs131 [myo-3p::GCaMP3::UrSL2::tagRFP-T]. hpIs758 [rig-3p::LoxP::eBFP::LoxP::Chrimson::wCherry + twk-40(s)p::Cre + myo-2p::wCherry]. Pick animals with red fluorescence to maintain. Shrinker. RFP expression in AVA and a few other neurons. Reversal upon green light illumination with ATR. hpIs758 is a spontaneous insertion of hpEx4080. Reference: Lu Y, et al. 2022. Current Biology (In Press). | WBGene00006762(unc-25) | WBGene00006762(unc-25) | WB-STRAIN:WBStrain00055686 | WormBase (WB) | WB | unknown | 2026-08-01 10:24:46 | 0 | ||||
|
unc-25(e156) III; hpIs593; ljIs131. Resource Report Resource Website |
RRID:WB-STRAIN:WBStrain00055683 | Caenorhabditis elegans | unc-25(e156) III; hpIs593; ljIs131. | hpIs593 [ttr-39p::Chrimson::wCherry + lin-15(+)]. ljIs131 [myo-3p::GCaMP3::UrSL2::tagRFP-T]. Shrinker. D motor neurons are marked with red fluorescence. No behavioral change upon green light illumination with ATR. Reference: Lu Y, et al. 2022. Current Biology (In Press). | WBGene00006762(unc-25) | WBGene00006762(unc-25) | WB-STRAIN:WBStrain00055683 | WormBase (WB) | WB | unknown | 2026-08-01 10:24:46 | 0 | ||||
|
hpIs625; ljIs131. Resource Report Resource Website |
RRID:WB-STRAIN:WBStrain00055726 | Caenorhabditis elegans | hpIs625; ljIs131. | hpIs625 [ttr-39p::Arch::wCherry + lin-15(+)]. ljIs131 [myo-3p::GCaMP3::UrSL2::tagRFP-T]. Reference: Lu Y, et al. 2022. Current Biology (In Press). | WB-STRAIN:WBStrain00055726 | WormBase (WB) | WB | unknown | 2026-08-01 10:24:49 | 0 | ||||||
|
unc-25(e156) III; ljIs131. Resource Report Resource Website |
RRID:WB-STRAIN:WBStrain00055725 | Caenorhabditis elegans | unc-25(e156) III; ljIs131. | ljIs131 [myo-3p::GCaMP3::UrSL2::tagRFP-T]. Shrinker. Reference: Lu Y, et al. 2022. Current Biology (In Press). | WBGene00006762(unc-25) | WBGene00006762(unc-25) | WB-STRAIN:WBStrain00055725 | WormBase (WB) | WB | unknown | 2026-08-01 10:24:47 | 0 | ||||
|
hpIs592; hpIs595. Resource Report Resource Website |
RRID:WB-STRAIN:WBStrain00055689 | Caenorhabditis elegans | hpIs592; hpIs595. | hpIs592 [ttr-39p::Chrimson::wCherry + lin-15(+)]. hpIs595 [acr-2(s)p::GCaMP6s::wCherry + lin-15(+)]. Body relaxation upon green light illumination with ATR. Red fluorescence in D motor neurons. Reference: Lu Y, et al. 2022. Current Biology (In Press). | WB-STRAIN:WBStrain00055689 | WormBase (WB) | WB | unknown | 2026-08-01 10:24:47 | 0 | ||||||
|
twk-40(bln282[twk-40::TagRFP::ZF]) III; hpEx4120. Resource Report Resource Website |
RRID:WB-STRAIN:WBStrain00055688 | Caenorhabditis elegans | twk-40(bln282[twk-40::TagRFP::ZF]) III; hpEx4120. | hpEx4120 [rgef-1p::GPI::YFP]. Pick YFP+ animals to maintain. TagRFP::ZF tag inserted into endogenous twk-40 locus. | WBGene00006691(twk-40) | WBGene00006691(twk-40) | WB-STRAIN:WBStrain00055688 | WormBase (WB) | WB | unknown | PMID:38598630 | 2026-08-01 10:24:47 | 0 | |||
|
twk-40(hp834) III. Resource Report Resource Website |
RRID:WB-STRAIN:WBStrain00055721 | Caenorhabditis elegans | twk-40(hp834) III. | Loss-of-function allele. Loopy movement with increased reversals. | WBGene00006691(twk-40) | WBGene00006691(twk-40) | WB-STRAIN:WBStrain00055721 | WormBase (WB) | WB | unknown | PMID:38598630 | 2026-08-01 10:24:48 | 0 | |||
|
hpIs371; hpIs365. Resource Report Resource Website |
RRID:WB-STRAIN:WBStrain00055723 | Caenorhabditis elegans | hpIs371; hpIs365. | hpIs371 [unc-4p::miniSOG::SL2::wCherry + lin-15(+)]. hpIs365 [unc-25p::GCaMP3::wCherry + lin-15(+)]. Red fluorescence in motor neurons. Reference: Lu Y, et al. 2022. Current Biology (In Press). | WB-STRAIN:WBStrain00055723 | WormBase (WB) | WB | unknown | 2026-08-01 10:24:49 | 0 | ||||||
|
flp-14(gk1055) III; hpSi38; hpIs201. Resource Report Resource Website |
RRID:WB-STRAIN:WBStrain00055729 | Caenorhabditis elegans | flp-14(gk1055) III; hpSi38; hpIs201. | hpSi38 [flp-14(+) + NeoR]. hpIs201[ceh-10p::GFP + lin-15(+)]. GFP expression in RID neuron. Neomycin-resistant. hpSi38 is a single copy miniMos insertion a wild-type genomic fragment containing flp-14 and fully rescues the flp-14 mutant behavioral defects and RID axon defects. Reference: Lim MA, et al. Elife. 2016 Nov 18;5:e19887. doi: 10.7554/eLife.19887. PMID: 27855782|"Made_by: Jun" | WBGene00001457(flp-14) | WBGene00001457(flp-14) | WB-STRAIN:WBStrain00055729 | WormBase (WB) | WB | unknown | 2026-08-01 10:24:49 | 0 | ||||
|
unc-116(rh24sb79) III; oyIs14 V. Resource Report Resource Website |
RRID:WB-STRAIN:WBStrain00055676 | Caenorhabditis elegans | unc-116(rh24sb79) III; oyIs14 V. | Made_by: Chen Ding|"oyIs14 [sra-6p::GFP + lin-15(+)]. Disrupted mitochondrial trafficking. sb79 is an intragenic suppressor of the rh24 gain-of-function allele. Reference: Ding C, et al. Elife. 2022 Mar 14;11:e73557. PMID: 35285800." | WBGene00006840(unc-116) | WBGene00006840(unc-116) | WB-STRAIN:WBStrain00055676 | WormBase (WB) | WB | unknown | 2026-08-01 10:24:47 | 0 | ||||
|
wpIs107 I. Resource Report Resource Website |
RRID:WB-STRAIN:WBStrain00055670 | Caenorhabditis elegans | wpIs107 I. | Made_by: Marc Hammarlund Lab|"wpIs107 [F49C12.10p::GFP] I. GFP expression in CAN neurons can be used to isolate CAN by FACS. F49C12.10 also known as nemt-1. Used by CeNGEN project for RNA-Seq (https:"|"wpIs107 [F49C12.10p::GFP] I. GFP expression in CAN neurons can be used to isolate CAN by FACS. Used by CeNGEN project for RNA-Seq (https:" | WB-STRAIN:WBStrain00055670 | WormBase (WB) | WB | unknown | 2026-08-01 10:24:47 | 0 | ||||||
|
wpIs98 unc-13(e51) I; ric-7(n2657) V. Resource Report Resource Website |
RRID:WB-STRAIN:WBStrain00055671 | Caenorhabditis elegans | wpIs98 unc-13(e51) I; ric-7(n2657) V. | Made_by: Chen Ding|"wpIs98 [itr-1pB::Chrimson::SL2::mCherry + odr-1p::RFP] I. Reference: Ding C & Hammarlund M. Elife. 2018 Oct 29;7. pii: e38829. doi: 10.7554/eLife.38829." | WBGene00006752(unc-13)|WBGene00010259(ric-7) | WBGene00006752(unc-13), WBGene00010259(ric-7) | WB-STRAIN:WBStrain00055671 | WormBase (WB) | WB | unknown | 2026-08-01 10:24:46 | 0 | ||||
|
twk-40(bln336) III; hpEx4479. Resource Report Resource Website |
RRID:WB-STRAIN:WBStrain00055714 | Caenorhabditis elegans | twk-40(bln336) III; hpEx4479. | hpEx4479 [npr-4p::snb-1::pHluorin + lin-15(+)]. Pick animals with green fluorescence in VNC to maintain. twk-40(bln336) is a gain-of-function allele. Paralyzed; no backward movement upon head touch. Synapse exocytosis marker for AVA. Transgenic animals exhibit punctate fluorescent signals along AVA neurites in the ventral cord, with weaker expression than in a wild-type background. | WBGene00006691(twk-40) | WBGene00006691(twk-40) | WB-STRAIN:WBStrain00055714 | WormBase (WB) | WB | unknown | PMID:38598630 | 2026-08-01 10:24:49 | 0 |
Can't find your Organism?
We recommend that you click next to the search bar to check some helpful tips on searches and refine your search firstly. If you want to find a specific organism, it's easier to enter an RRID or a Catalog Number to search. You can refine the search results using Facets on the left side of the search results page. If you are on the table view, you can also search in a specific column by clicking the column title and enter the keywords.
If you still could not find your organism in the search results, please help us by registering it into the system — it's easy. Organisms identifiers are registered through multiple sources depending on the species:
Welcome to the NIF Resources search. From here you can search through a compilation of resources used by NIF and see how data is organized within our community.
You are currently on the Community Resources tab looking through categories and sources that NIF has compiled. You can navigate through those categories from here or change to a different tab to execute your search through. Each tab gives a different perspective on data.
If you have an account on NIF then you can log in from here to get additional features in NIF such as Collections, Saved Searches, and managing Resources.
Here is the search term that is being executed, you can type in anything you want to search for. Some tips to help searching:
If you are logged into NIF you can add data records to your collections to create custom spreadsheets across multiple sources of data.
Here are the facets that you can filter the data by.
If you have any further questions please check out our FAQs Page to ask questions and see our tutorials. Click this button to view this tutorial again.
Welcome to the Neuroscience Information Framework Project, designed to serve the biomedical research community. NIF maintains the largest searchable collection of neuroscience data, the largest catalog of biomedical resources, and the largest ontology for neuroscience on the web. We welcome all feedback and suggestions and are actively looking for resource providers to make their resources accessible through NIF. Learn about the tools available to help you share your data and discover a dynamic inventory of Web-based neuroscience resources.
