Searching the RRID Resource Information Network

Our searching services are busy right now. Please try again later

  • Register
X
Forgot Password

If you have forgotten your password you can enter your email here and get a temporary password sent to your email.

X

Leaving Community

Are you sure you want to leave this community? Leaving the community will revoke any permissions you have been granted in this community.

No
Yes

Preparing word cloud

×

Integrated Animals is a virtual database currently indexing available animal strains and mutants from: AGSC (Ambystoma), BCBC (mice), BDSC (flies), European Xenopus Resource Center (frog), The National Xenopus Resource (frog), Xenopus Express (frog), CWRU Cystic Fibrosis Mouse Models (mice), DGGR (flies), FlyBase (flies), IMSR (mice), MGI (mice), MMRRC (mice), NSRRC (pig), RGD (rats), Sperm Stem Cell Libraries for Biological Research (rats), Tetrahymena Stock Center (Tetrahymena), WormBase (worms), XGSC (Xiphophorus), ZFIN (zebrafish), and ZIRC (zebrafish). Note, the IMSR data is linked, but users may need to re-execute the search if the top mouse is not returned properly.
Note: BCBC is no longer in service, so the links may not be functional.

Suggested Search Criteria

Enter extra filters to help narrow your search

Search

Type in a keyword to search

Filter by records added date
See new records

Options


Current Facets and Filters

  • Database:WB (facet)

Facets


Recent searches

Snippet view Table view
Click the to add this resource to a Collection

64,152 Results - per page

Show More Columns | Download Top 1000 Results

Organism Name Proper Citation Species Synonyms Notes Phenotype Affected Gene Genomic Alteration Catalog Number Background Database Database Abbreviation Availability Source References Alternate IDs Record Last Update Mentions Count
RB1914
 
Resource Report
Resource Website
RRID:WB-STRAIN:WBStrain00032599 Caenorhabditis elegans aqp-9(ok2487) I. K07A1.16 Homozygous. Outer Left Sequence: gggaaaatcttgcgtttgaa. Outer Right Sequence: ctggacggaagattgtggat. Inner Left Sequence: cccacaaactctactccccc. Inner Right Sequence: tttaaaagctcaaactcaagaacc. Inner Primer PCR Length: 1134. Deletion size: about 600 bp.|"Made_by: OMRF Knockout Group"|"This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use." WBGene00000177(aqp-9) WBGene00000177(aqp-9) WB-STRAIN:WBStrain00032599 WormBase (WB) WB available WB-STRAIN:RB1914, CGC_RB1914 2026-09-19 11:07:20 0
RB1829
 
Resource Report
Resource Website
RRID:WB-STRAIN:WBStrain00032520 Caenorhabditis elegans F22G12.5(ok2367) I. F22G12.5. Homozygous. Outer Left Sequence: GAAAAGGGGTTAGGAGCAGG. Outer Right Sequence: CCCCTAGATCTGACACTGCC. Inner Left Sequence: TCAAATCGGCTAATTTTCGG. Inner Right Sequence: TCGTCTGCATCTGTGTGTCA. Inner Primer PCR Length: 3163 bp. Deletion Size: 1478 bp. Deletion left flank: TAGAGATTTGCCACGGAGATTCTTCGAGCT. Deletion right flank: ACAGCATCCTGTCTAGATCTAGGCTTAACC.|"Made_by: OMRF Knockout Group"|"This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use." WBGene00009065(dock-11) WBGene00009065(dock-11) WB-STRAIN:WBStrain00032520 WormBase (WB) WB available WB-STRAIN:RB1829, CGC_RB1829 2026-09-19 11:07:18 0
RB1839
 
Resource Report
Resource Website
RRID:WB-STRAIN:WBStrain00032529 Caenorhabditis elegans C18H2.2(ok2379) III. C18H2.2. Homozygous. Outer Left Sequence: AAGTTGGAACCTTGGAGCCT. Outer Right Sequence: ACAGCGTCGTTGAAAGATCA. Inner Left Sequence: AACTGCTCCCATGTGACCTAA. Inner Right Sequence: CACTTCTGAAAATTCCACCGA. Inner Primer PCR Length: 3037 bp. Deletion Size: 1531 bp. Deletion left flank: TATTTTTCGTGTAACAATCTATTTTTCGTGGAACAATCTATTTTTCGTGTAACAATCTA TTTTTCGTGTAACAATCTATTTTTCGTGTAACAATCTATTTTTCGTGTAACAATCTATT TTTC. Deletion right flank: ATCATCTTTGGATGTGACCAGCGCTGAATT.|"C18H2.2. Homozygous. Outer Left Sequence: AAGTTGGAACCTTGGAGCCT. Outer Right Sequence: ACAGCGTCGTTGAAAGATCA. Inner Left Sequence: AACTGCTCCCATGTGACCTAA. Inner Right Sequence: CACTTCTGAAAATTCCACCGA. Inner Primer PCR Length: 3037 bp. Deletion Size: 1531 bp. Deletion left flank: TATTTTTCGTGTAACAATCTATTTTTCGTGGAACAATCTATTTTTCGTGTAACAATCTATTTTTCGTGTAACAATCTATTTTTCGTGTAACAATCTATTTTTCGTGTAACAATCTATTTTTC. Deletion right flank: ATCATCTTTGGATGTGACCAGCGCTGAATT."|"Made_by: OMRF Knockout Group"|"This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use." WBGene00015989(C18H2.2) WBGene00015989(C18H2.2) WB-STRAIN:WBStrain00032529 WormBase (WB) WB available WB-STRAIN:RB1839, CGC_RB1839 2026-09-19 11:07:19 0
RB1837
 
Resource Report
Resource Website
RRID:WB-STRAIN:WBStrain00032528 Caenorhabditis elegans C54A12.2(ok2376) II. C54A12.2. Homozygous. Outer Left Sequence: AGGCTACCGTGTCGGTATTG. Outer Right Sequence: TCAGTCGGCAACGTATGAAA. Inner Left Sequence: GAAAAATGTTGAGGCGGTGT. Inner Right Sequence: ATCTTTGGCATGTTTGGCTC. Inner Primer PCR Length: 2721 bp. Deletion Size: 1540 bp. Deletion left flank: TCCCACTTCCTTCTGCAATAACCTTAACAC. Deletion right flank: CAGAGAATGCAATTTGATAATGATGGTTCC.|"Made_by: OMRF Knockout Group"|"This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use." WBGene00016909(frpr-4) WBGene00016909(frpr-4) WB-STRAIN:WBStrain00032528 WormBase (WB) WB available WB-STRAIN:RB1837, CGC_RB1837 2026-09-19 11:07:19 0
RB1835
 
Resource Report
Resource Website
RRID:WB-STRAIN:WBStrain00032526 Caenorhabditis elegans F41D9.1(ok2374) X. F41D9.1 Homozygous. Outer Left Sequence: tcgtgctccactctcatttg. Outer Right Sequence: gttgaaccgatcggaagaga. Inner Left Sequence: aagaaaggtgagcgctgtgt. Inner Right Sequence: gccttgtggcctaatggata. Inner Primer PCR Length: 3251. Deletion size: about 1200 bp.|"Made_by: OMRF Knockout Group"|"This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use." WBGene00018281(tbc-18) WBGene00018281(tbc-18) WB-STRAIN:WBStrain00032526 WormBase (WB) WB available WB-STRAIN:RB1835, CGC_RB1835 2026-09-19 11:07:19 0
RB1834
 
Resource Report
Resource Website
1+ mentions
RRID:WB-STRAIN:WBStrain00032525 Caenorhabditis elegans che-7(ok2373) V. F26D11.10. Homozygous. Outer Left Sequence: AAAATTCGTCCGAGTCGTTG. Outer Right Sequence: GAGCAGTGGCTCTTTGCTCT. Inner Left Sequence: TGATTCTGGCCATCAGAATTT. Inner Right Sequence: GGGGCACAAAAATGAGAGAA. Inner Primer PCR Length: 3059 bp. Deletion Size: 1496 bp. Deletion left flank: TGCCCACGTACATTATTTTTGTCGCCTGAA. Deletion right flank: GCACTGCCATCATAATAAGAAACGATGATG.|"Made_by: OMRF Knockout Group"|"This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use." WBGene00000488(che-7) WBGene00000488(che-7) WB-STRAIN:WBStrain00032525 WormBase (WB) WB available PMID:36652499
PMID:38302462
WB-STRAIN:RB1834, CGC_RB1834 2026-09-19 11:07:19 1
RB2013
 
Resource Report
Resource Website
RRID:WB-STRAIN:WBStrain00032697 Caenorhabditis elegans T08A9.13(ok2666) X. Made_by: OMRF Knockout Group|"T08A9.13. Homozygous. Outer Left Sequence: AAGAAAAGCTTGCAACGAGC. Outer Right Sequence: AGCTCCAATTGCAGTTTCGT. Inner Left Sequence: TCAATTGTTCCCCACTCTCC. Inner Right Sequence: CAATGCCACTTCGGTTTCTT. Inner Primer PCR Length: 2631 bp. Deletion Size: 1432 bp. Deletion left flank: AATGTACTAAACATTTATACTATGTTGCAA. Deletion right flank: TTGAGAAGCTTTTTGTGCAGCAATAATGGC. Insertion Sequence: A."|"This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use." WBGene00044442(T08A9.13) WBGene00044442(T08A9.13) WB-STRAIN:WBStrain00032697 WormBase (WB) WB available WB-STRAIN:RB2013, CGC_RB2013 2026-09-19 11:07:21 0
RB2012
 
Resource Report
Resource Website
RRID:WB-STRAIN:WBStrain00032696 Caenorhabditis elegans T21C9.11(ok2664) V. Made_by: OMRF Knockout Group|"T21C9.11. Homozygous. Outer Left Sequence: AAAATTTGAATCGGGCGTTA. Outer Right Sequence: ACTCTTTCGCCTGAAATCCA. Inner Left Sequence: CGATTTTTGTACATTCAGGCAA. Inner Right Sequence: TTTCTGGTCGAAAGTGGTCA. Inner Primer PCR Length: 3024 bp. Deletion Size: 2525 bp. Deletion left flank: AGGCAAAAATCCATTTGTTCCGTCATTTTT. Deletion right flank: GAAATGCCACGTCAGCAGAGTGAAATGTGG. Insertion Sequence: GAACGAAAAAT."|"This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use." WBGene00011896(T21C9.11) WBGene00011896(T21C9.11) WB-STRAIN:WBStrain00032696 WormBase (WB) WB available WB-STRAIN:RB2012, CGC_RB2012 2026-09-19 11:07:21 0
RB2011
 
Resource Report
Resource Website
RRID:WB-STRAIN:WBStrain00032695 Caenorhabditis elegans ugt-62 M88.1. Homozygous. Outer Left Sequence: AAACATGGTTCCCGACATTC. Outer Right Sequence: AATTCGGTGCATTTGGAAAA. Inner Left Sequence: GCAACTTTGGAATTTTTGGG. Inner Right Sequence: ATCAGATTTCCTGCGCAACT. Inner Primer PCR Length: 3024 bp. Deletion Size: 1367 bp. Deletion left flank: ACGCTAAATTGTTTTAATACATTTTAAAGT. Deletion right flank: ATGAAATATTTCTCGATTAAAGTTTCTCAG.|"Made_by: OMRF Knockout Group"|"This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use." WBGene00010904(ugt-62) WBGene00010904(ugt-62) WB-STRAIN:WBStrain00032695 WormBase (WB) WB available PMID:38488606 WB-STRAIN:RB2011, CGC_RB2011 2026-09-19 11:07:21 0
RB2006
 
Resource Report
Resource Website
RRID:WB-STRAIN:WBStrain00032690 Caenorhabditis elegans spi-1(ok2658) II. Made_by: OMRF Knockout Group|"R10H1.4. Homozygous. Outer Left Sequence: TTGGTCACTGATATGCGCTC. Outer Right Sequence: AAGTCGACCGAGTCGTCAAT. Inner Left Sequence: GGGAAATGAAAATAAGGTCAATG. Inner Right Sequence: TGCTCAACGAGATGTGGAAA. Inner Primer PCR Length: 1194 bp. Deletion Size: 711 bp. Deletion left flank: ATGACCGAGACTGGTCCGACCTCCGATATT. Deletion right flank: GGATTAAATGAAGTTTGGATGGTTTGTTCA."|"This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use." WBGene00023416(spi-1) WBGene00023416(spi-1) WB-STRAIN:WBStrain00032690 WormBase (WB) WB available WB-STRAIN:RB2006, CGC_RB2006 2026-09-19 11:07:21 0
RB1932
 
Resource Report
Resource Website
RRID:WB-STRAIN:WBStrain00032617 Caenorhabditis elegans ZK418.8(ok2535) III. Made_by: OMRF Knockout Group|"This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use."|"ZK418.8 Homozygous. Outer Left Sequence: aaaaccggtgaagtttgagg. Outer Right Sequence: catttgcgaaatgggaaagt. Inner Left Sequence: ttttcgagctacaacgacttttt. Inner Right Sequence: attgcgagcccatttgttat. Inner Primer PCR Length: 3125. Deletion size: about 1100 bp." WBGene00022737(tofu-7) WBGene00022737(tofu-7) WB-STRAIN:WBStrain00032617 WormBase (WB) WB available WB-STRAIN:RB1932, CGC_RB1932 2026-09-19 11:07:20 0
RB1928
 
Resource Report
Resource Website
RRID:WB-STRAIN:WBStrain00032613 Caenorhabditis elegans exoc-8(ok2523) I. Made_by: OMRF Knockout Group|"This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use."|"Y105E8B.2. Homozygous. Outer Left Sequence: CTACCGACTGAGCTATCCGC. Outer Right Sequence: AAATTTCATGGCGTTTTTGG. Inner Left Sequence: TTTCGCAAAATGCACAACAT. Inner Right Sequence: GCCCCAGTCAACGTTAAAGA. Inner Primer PCR Length: 2583 bp. Deletion Size: 1474 bp. Deletion left flank: TTAAAAATGAACAAATTTTTTGGAAAATCT. Deletion right flank: TCACAGTTTGCCGTTTTCCTCGAATAGTTG." WBGene00013687(exoc-8) WBGene00013687(exoc-8) WB-STRAIN:WBStrain00032613 WormBase (WB) WB available PMID:38302462 WB-STRAIN:RB1928, CGC_RB1928 2026-09-19 11:07:20 0
RB1927
 
Resource Report
Resource Website
RRID:WB-STRAIN:WBStrain00032612 Caenorhabditis elegans C38D4.4(ok2513) III. C38D4.4. Homozygous. Outer Left Sequence: ACAAGAGGTGGAAGAGCCAA. Outer Right Sequence: CTATCCTTATCCGACGGCAA. Inner Left Sequence: AAGAAACGGCTGCGGTAATA. Inner Right Sequence: TGATAGCTTCTAGACACTCATTATC. Inner Primer PCR Length: 3063 bp. Deletion Size: 1751 bp. Deletion left flank: TATTTGTCCTTATTTATTTTATTATTTGAA. Deletion right flank: AATTGACCGAAATCTACGATAAGCATTTCG. Insertion Sequence: CCGA.|"Made_by: OMRF Knockout Group"|"This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use." WBGene00008005(mip-1) WBGene00008005(mip-1) WB-STRAIN:WBStrain00032612 WormBase (WB) WB available WB-STRAIN:RB1927, CGC_RB1927 2026-09-19 11:07:20 0
RB1926
 
Resource Report
Resource Website
RRID:WB-STRAIN:WBStrain00032611 Caenorhabditis elegans T02G5.3&mmaa-1(ok2512) II. Made_by: OMRF Knockout Group|"T02G5.1, T02G5.13. Homozygous. Outer Left Sequence: TGATTGGTGCACTGGTCATT. Outer Right Sequence: AATCACGATACCTTGGACGC. Inner Left Sequence: TCGTTTCGAAATTCGTCCTC. Inner Right Sequence: ATGCCTGGTGACGACTACCT. Inner Primer PCR Length: 2798 bp. Deletion Size: 1381 bp. Deletion left flank: GTTTATACTCTGGAAAAAGTTACAAAATCA. Deletion right flank: GTGGGATCAATTGTTAAAACTGCAACTTTC."|"This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use." WBGene00020163(T02G5.3)|WBGene00020169(mmaa-1) WBGene00020163(T02G5.3), WBGene00020169(mmaa-1) WB-STRAIN:WBStrain00032611 WormBase (WB) WB available WB-STRAIN:RB1926, CGC_RB1926 2026-09-19 11:07:20 0
RB2015
 
Resource Report
Resource Website
RRID:WB-STRAIN:WBStrain00032699 Caenorhabditis elegans acs-5(ok2668) III. Made_by: OMRF Knockout Group|"This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use."|"Y76A2B.3 Homozygous. Outer Left Sequence: aacaacacgttgctggagtg. Outer Right Sequence: ccacccatggcctaactcta. Inner Left Sequence: tctaatcgagttggattcacg. Inner Right Sequence: tgcaattacagggtcaacca. Inner Primer PCR Length: 3069. Deletion size: about 1700 bp." WBGene00013575(acs-5) WBGene00013575(acs-5) WB-STRAIN:WBStrain00032699 WormBase (WB) WB available WB-STRAIN:RB2015, CGC_RB2015 2026-09-19 11:07:21 0
RB1925
 
Resource Report
Resource Website
RRID:WB-STRAIN:WBStrain00032610 Caenorhabditis elegans C49G9.1(ok2504) I. C49G9.1. Homozygous. Outer Left Sequence: TTTTAAGCCATAACACCCGC. Outer Right Sequence: ATGCATCGACGAATACACCA. Inner Left Sequence: CCAGGAAATTGTCAACACGA. Inner Right Sequence: ATCCCTTCCTCCACATCTCA. Inner Primer PCR Length: 1210 bp. Deletion Size: 385 bp. Deletion left flank: TAAGGATTTGATAATTTCATGAAAATTAAA. Deletion right flank: ATCCAAATTTTTTTTTTCCAAAATTTTTTT.|"Made_by: OMRF Knockout Group"|"This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use." WBGene00008216(mec-19) WBGene00008216(mec-19) WB-STRAIN:WBStrain00032610 WormBase (WB) WB available WB-STRAIN:RB1925, CGC_RB1925 2026-09-19 11:07:20 0
RB1934
 
Resource Report
Resource Website
RRID:WB-STRAIN:WBStrain00032619 Caenorhabditis elegans W07B8.4(ok2537) V. Made_by: OMRF Knockout Group|"This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use."|"W07B8.4 Homozygous. Outer Left Sequence: caatggggtttcaaagcaat. Outer Right Sequence: gccgattttcagttagcctg. Inner Left Sequence: catgtattcctcgggattcg. Inner Right Sequence: ttcgctctgattcacttcca. Inner Primer PCR Length: 3069. Deletion size: about 1400 bp." WBGene00021072(W07B8.4) WBGene00021072(W07B8.4) WB-STRAIN:WBStrain00032619 WormBase (WB) WB available WB-STRAIN:RB1934, CGC_RB1934 2026-09-19 11:07:20 0
RB1941
 
Resource Report
Resource Website
RRID:WB-STRAIN:WBStrain00032626 Caenorhabditis elegans rbr-2(ok2544) IV. Made_by: OMRF Knockout Group|"This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use."|"ZK593.4. Homozygous. Outer Left Sequence: GAGGGGAAGATGAGTGTCCA. Outer Right Sequence: GCATGTCAGTGTTGATTCGG. Inner Left Sequence: TGCGTTGCTTGTAATGAAGG. Inner Right Sequence: TGAGCATGCTTCAAGACCAC. Inner Primer PCR Length: 3298 bp. Deletion Size: 1311 bp. Deletion left flank: CGAGTCGAGTAGGAAGTGGATTTCCTCGAA. Deletion right flank: GAGCAAAAGATGCTATCTATCGAGAACAAG." WBGene00004319(rbr-2) WBGene00004319(rbr-2) WB-STRAIN:WBStrain00032626 WormBase (WB) WB available WB-STRAIN:RB1941, CGC_RB1941 2026-09-19 11:07:20 0
RB1939
 
Resource Report
Resource Website
RRID:WB-STRAIN:WBStrain00032624 Caenorhabditis elegans C50A2.2(ok2542) IV. C50A2.2. Homozygous. Outer Left Sequence: AAAATCGTCGTCGAAACCTG. Outer Right Sequence: CTGACGCAAAATTGCAGAAA. Inner Left Sequence: ACAACGAACCGAGCCGAT. Inner Right Sequence: GTGCGTATTGGGAAGGTAGC. Inner Primer PCR Length: 3005 bp. Deletion Size: 1982 bp. Deletion left flank: ATTTAGTGTGACTAGGTTACTGTAGCACCA. Deletion right flank: CGTCAGATTGTGTTTACCAACAAAAAAAAT. Insertion Sequence: GACTTTTTTCTGCAATTTTG.|"Made_by: OMRF Knockout Group"|"This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use." WBGene00016796(cec-2) WBGene00016796(cec-2) WB-STRAIN:WBStrain00032624 WormBase (WB) WB available WB-STRAIN:RB1939, CGC_RB1939 2026-09-19 11:07:20 0
RB1936
 
Resource Report
Resource Website
RRID:WB-STRAIN:WBStrain00032621 Caenorhabditis elegans M28.4(ok2539) II. M28.4 Homozygous. Outer Left Sequence: agcgattccaaaatcactgg. Outer Right Sequence: tgcctggtaggcagaaaagt. Inner Left Sequence: cgctggattgttggttatca. Inner Right Sequence: gtcattggaattggaggtgg. Inner Primer PCR Length: 3023. Deletion size: about 2000 bp.|"Made_by: OMRF Knockout Group"|"This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use." WBGene00010895(M28.4) WBGene00010895(M28.4) WB-STRAIN:WBStrain00032621 WormBase (WB) WB available WB-STRAIN:RB1936, CGC_RB1936 2026-09-19 11:07:20 0

Can't find your Organism?

We recommend that you click next to the search bar to check some helpful tips on searches and refine your search firstly. If you want to find a specific organism, it's easier to enter an RRID or a Catalog Number to search. You can refine the search results using Facets on the left side of the search results page. If you are on the table view, you can also search in a specific column by clicking the column title and enter the keywords.

If you still could not find your organism in the search results, please help us by registering it into the system — it's easy. Organisms identifiers are registered through multiple sources depending on the species:

Can't find the RRID you're searching for? X
X
  1. Neuroscience Information Framework Resources

    Welcome to the NIF Resources search. From here you can search through a compilation of resources used by NIF and see how data is organized within our community.

  2. Navigation

    You are currently on the Community Resources tab looking through categories and sources that NIF has compiled. You can navigate through those categories from here or change to a different tab to execute your search through. Each tab gives a different perspective on data.

  3. Logging in and Registering

    If you have an account on NIF then you can log in from here to get additional features in NIF such as Collections, Saved Searches, and managing Resources.

  4. Searching

    Here is the search term that is being executed, you can type in anything you want to search for. Some tips to help searching:

    1. Use quotes around phrases you want to match exactly
    2. You can manually AND and OR terms to change how we search between words
    3. You can add "-" to terms to make sure no results return with that term in them (ex. Cerebellum -CA1)
    4. You can add "+" to terms to require they be in the data
    5. Using autocomplete specifies which branch of our semantics you with to search and can help refine your search
  5. Collections

    If you are logged into NIF you can add data records to your collections to create custom spreadsheets across multiple sources of data.

  6. Facets

    Here are the facets that you can filter the data by.

  7. Further Questions

    If you have any further questions please check out our FAQs Page to ask questions and see our tutorials. Click this button to view this tutorial again.