Are you sure you want to leave this community? Leaving the community will revoke any permissions you have been granted in this community.
Integrated Animals is a virtual database currently indexing available animal strains and mutants from: AGSC (Ambystoma), BCBC (mice), BDSC (flies), European Xenopus Resource Center (frog), The National Xenopus Resource (frog), Xenopus Express (frog), CWRU Cystic Fibrosis Mouse Models (mice), DGGR (flies), FlyBase (flies), IMSR (mice), MGI (mice), MMRRC (mice), NSRRC (pig), RGD (rats), Sperm Stem Cell Libraries for Biological Research (rats), Tetrahymena Stock Center (Tetrahymena), WormBase (worms), XGSC (Xiphophorus), ZFIN (zebrafish), and ZIRC (zebrafish). Note, the IMSR data is linked, but users may need to re-execute the search if the top mouse is not returned properly.
Note: BCBC is no longer in service, so the links may not be functional.
http://www.wormbase.org/db/get?name=WBStrain00032599
Source Database: WormBase (WB)
Affected Genes: WBGene00000177(aqp-9)
Genomic Alteration: WBGene00000177(aqp-9)
Availability: available
Source References: EMPTY
Synonyms: aqp-9(ok2487) I.
Alternate IDs: WB-STRAIN:RB1914, CGC_RB1914
Notes: K07A1.16 Homozygous. Outer Left Sequence: gggaaaatcttgcgtttgaa. Outer Right Sequence: ctggacggaagattgtggat. Inner Left Sequence: cccacaaactctactccccc. Inner Right Sequence: tttaaaagctcaaactcaagaacc. Inner Primer PCR Length: 1134. Deletion size: about 600 bp.|"Made_by: OMRF Knockout Group"|"This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use."
Proper citation: RRID:WB-STRAIN:WBStrain00032599 Copy
http://www.wormbase.org/db/get?name=WBStrain00032520
Source Database: WormBase (WB)
Affected Genes: WBGene00009065(dock-11)
Genomic Alteration: WBGene00009065(dock-11)
Availability: available
Source References: EMPTY
Synonyms: F22G12.5(ok2367) I.
Alternate IDs: WB-STRAIN:RB1829, CGC_RB1829
Notes: F22G12.5. Homozygous. Outer Left Sequence: GAAAAGGGGTTAGGAGCAGG. Outer Right Sequence: CCCCTAGATCTGACACTGCC. Inner Left Sequence: TCAAATCGGCTAATTTTCGG. Inner Right Sequence: TCGTCTGCATCTGTGTGTCA. Inner Primer PCR Length: 3163 bp. Deletion Size: 1478 bp. Deletion left flank: TAGAGATTTGCCACGGAGATTCTTCGAGCT. Deletion right flank: ACAGCATCCTGTCTAGATCTAGGCTTAACC.|"Made_by: OMRF Knockout Group"|"This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use."
Proper citation: RRID:WB-STRAIN:WBStrain00032520 Copy
http://www.wormbase.org/db/get?name=WBStrain00032529
Source Database: WormBase (WB)
Affected Genes: WBGene00015989(C18H2.2)
Genomic Alteration: WBGene00015989(C18H2.2)
Availability: available
Source References: EMPTY
Synonyms: C18H2.2(ok2379) III.
Alternate IDs: WB-STRAIN:RB1839, CGC_RB1839
Notes: C18H2.2. Homozygous. Outer Left Sequence: AAGTTGGAACCTTGGAGCCT. Outer Right Sequence: ACAGCGTCGTTGAAAGATCA. Inner Left Sequence: AACTGCTCCCATGTGACCTAA. Inner Right Sequence: CACTTCTGAAAATTCCACCGA. Inner Primer PCR Length: 3037 bp. Deletion Size: 1531 bp. Deletion left flank: TATTTTTCGTGTAACAATCTATTTTTCGTGGAACAATCTATTTTTCGTGTAACAATCTA TTTTTCGTGTAACAATCTATTTTTCGTGTAACAATCTATTTTTCGTGTAACAATCTATT TTTC. Deletion right flank: ATCATCTTTGGATGTGACCAGCGCTGAATT.|"C18H2.2. Homozygous. Outer Left Sequence: AAGTTGGAACCTTGGAGCCT. Outer Right Sequence: ACAGCGTCGTTGAAAGATCA. Inner Left Sequence: AACTGCTCCCATGTGACCTAA. Inner Right Sequence: CACTTCTGAAAATTCCACCGA. Inner Primer PCR Length: 3037 bp. Deletion Size: 1531 bp. Deletion left flank: TATTTTTCGTGTAACAATCTATTTTTCGTGGAACAATCTATTTTTCGTGTAACAATCTATTTTTCGTGTAACAATCTATTTTTCGTGTAACAATCTATTTTTCGTGTAACAATCTATTTTTC. Deletion right flank: ATCATCTTTGGATGTGACCAGCGCTGAATT."|"Made_by: OMRF Knockout Group"|"This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use."
Proper citation: RRID:WB-STRAIN:WBStrain00032529 Copy
http://www.wormbase.org/db/get?name=WBStrain00032528
Source Database: WormBase (WB)
Affected Genes: WBGene00016909(frpr-4)
Genomic Alteration: WBGene00016909(frpr-4)
Availability: available
Source References: EMPTY
Synonyms: C54A12.2(ok2376) II.
Alternate IDs: WB-STRAIN:RB1837, CGC_RB1837
Notes: C54A12.2. Homozygous. Outer Left Sequence: AGGCTACCGTGTCGGTATTG. Outer Right Sequence: TCAGTCGGCAACGTATGAAA. Inner Left Sequence: GAAAAATGTTGAGGCGGTGT. Inner Right Sequence: ATCTTTGGCATGTTTGGCTC. Inner Primer PCR Length: 2721 bp. Deletion Size: 1540 bp. Deletion left flank: TCCCACTTCCTTCTGCAATAACCTTAACAC. Deletion right flank: CAGAGAATGCAATTTGATAATGATGGTTCC.|"Made_by: OMRF Knockout Group"|"This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use."
Proper citation: RRID:WB-STRAIN:WBStrain00032528 Copy
http://www.wormbase.org/db/get?name=WBStrain00032526
Source Database: WormBase (WB)
Affected Genes: WBGene00018281(tbc-18)
Genomic Alteration: WBGene00018281(tbc-18)
Availability: available
Source References: EMPTY
Synonyms: F41D9.1(ok2374) X.
Alternate IDs: WB-STRAIN:RB1835, CGC_RB1835
Notes: F41D9.1 Homozygous. Outer Left Sequence: tcgtgctccactctcatttg. Outer Right Sequence: gttgaaccgatcggaagaga. Inner Left Sequence: aagaaaggtgagcgctgtgt. Inner Right Sequence: gccttgtggcctaatggata. Inner Primer PCR Length: 3251. Deletion size: about 1200 bp.|"Made_by: OMRF Knockout Group"|"This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use."
Proper citation: RRID:WB-STRAIN:WBStrain00032526 Copy
http://www.wormbase.org/db/get?name=WBStrain00032525
Source Database: WormBase (WB)
Affected Genes: WBGene00000488(che-7)
Genomic Alteration: WBGene00000488(che-7)
Availability: available
Source References: PMID:36652499, PMID:38302462
Synonyms: che-7(ok2373) V.
Alternate IDs: WB-STRAIN:RB1834, CGC_RB1834
Notes: F26D11.10. Homozygous. Outer Left Sequence: AAAATTCGTCCGAGTCGTTG. Outer Right Sequence: GAGCAGTGGCTCTTTGCTCT. Inner Left Sequence: TGATTCTGGCCATCAGAATTT. Inner Right Sequence: GGGGCACAAAAATGAGAGAA. Inner Primer PCR Length: 3059 bp. Deletion Size: 1496 bp. Deletion left flank: TGCCCACGTACATTATTTTTGTCGCCTGAA. Deletion right flank: GCACTGCCATCATAATAAGAAACGATGATG.|"Made_by: OMRF Knockout Group"|"This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use."
Proper citation: RRID:WB-STRAIN:WBStrain00032525 Copy
http://www.wormbase.org/db/get?name=WBStrain00032697
Source Database: WormBase (WB)
Affected Genes: WBGene00044442(T08A9.13)
Genomic Alteration: WBGene00044442(T08A9.13)
Availability: available
Source References: EMPTY
Synonyms: T08A9.13(ok2666) X.
Alternate IDs: WB-STRAIN:RB2013, CGC_RB2013
Notes: Made_by: OMRF Knockout Group|"T08A9.13. Homozygous. Outer Left Sequence: AAGAAAAGCTTGCAACGAGC. Outer Right Sequence: AGCTCCAATTGCAGTTTCGT. Inner Left Sequence: TCAATTGTTCCCCACTCTCC. Inner Right Sequence: CAATGCCACTTCGGTTTCTT. Inner Primer PCR Length: 2631 bp. Deletion Size: 1432 bp. Deletion left flank: AATGTACTAAACATTTATACTATGTTGCAA. Deletion right flank: TTGAGAAGCTTTTTGTGCAGCAATAATGGC. Insertion Sequence: A."|"This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use."
Proper citation: RRID:WB-STRAIN:WBStrain00032697 Copy
http://www.wormbase.org/db/get?name=WBStrain00032696
Source Database: WormBase (WB)
Affected Genes: WBGene00011896(T21C9.11)
Genomic Alteration: WBGene00011896(T21C9.11)
Availability: available
Source References: EMPTY
Synonyms: T21C9.11(ok2664) V.
Alternate IDs: WB-STRAIN:RB2012, CGC_RB2012
Notes: Made_by: OMRF Knockout Group|"T21C9.11. Homozygous. Outer Left Sequence: AAAATTTGAATCGGGCGTTA. Outer Right Sequence: ACTCTTTCGCCTGAAATCCA. Inner Left Sequence: CGATTTTTGTACATTCAGGCAA. Inner Right Sequence: TTTCTGGTCGAAAGTGGTCA. Inner Primer PCR Length: 3024 bp. Deletion Size: 2525 bp. Deletion left flank: AGGCAAAAATCCATTTGTTCCGTCATTTTT. Deletion right flank: GAAATGCCACGTCAGCAGAGTGAAATGTGG. Insertion Sequence: GAACGAAAAAT."|"This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use."
Proper citation: RRID:WB-STRAIN:WBStrain00032696 Copy
http://www.wormbase.org/db/get?name=WBStrain00032695
Source Database: WormBase (WB)
Affected Genes: WBGene00010904(ugt-62)
Genomic Alteration: WBGene00010904(ugt-62)
Availability: available
Source References: PMID:38488606
Synonyms: ugt-62
Alternate IDs: WB-STRAIN:RB2011, CGC_RB2011
Notes: M88.1. Homozygous. Outer Left Sequence: AAACATGGTTCCCGACATTC. Outer Right Sequence: AATTCGGTGCATTTGGAAAA. Inner Left Sequence: GCAACTTTGGAATTTTTGGG. Inner Right Sequence: ATCAGATTTCCTGCGCAACT. Inner Primer PCR Length: 3024 bp. Deletion Size: 1367 bp. Deletion left flank: ACGCTAAATTGTTTTAATACATTTTAAAGT. Deletion right flank: ATGAAATATTTCTCGATTAAAGTTTCTCAG.|"Made_by: OMRF Knockout Group"|"This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use."
Proper citation: RRID:WB-STRAIN:WBStrain00032695 Copy
http://www.wormbase.org/db/get?name=WBStrain00032690
Source Database: WormBase (WB)
Affected Genes: WBGene00023416(spi-1)
Genomic Alteration: WBGene00023416(spi-1)
Availability: available
Source References: EMPTY
Synonyms: spi-1(ok2658) II.
Alternate IDs: WB-STRAIN:RB2006, CGC_RB2006
Notes: Made_by: OMRF Knockout Group|"R10H1.4. Homozygous. Outer Left Sequence: TTGGTCACTGATATGCGCTC. Outer Right Sequence: AAGTCGACCGAGTCGTCAAT. Inner Left Sequence: GGGAAATGAAAATAAGGTCAATG. Inner Right Sequence: TGCTCAACGAGATGTGGAAA. Inner Primer PCR Length: 1194 bp. Deletion Size: 711 bp. Deletion left flank: ATGACCGAGACTGGTCCGACCTCCGATATT. Deletion right flank: GGATTAAATGAAGTTTGGATGGTTTGTTCA."|"This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use."
Proper citation: RRID:WB-STRAIN:WBStrain00032690 Copy
http://www.wormbase.org/db/get?name=WBStrain00032617
Source Database: WormBase (WB)
Affected Genes: WBGene00022737(tofu-7)
Genomic Alteration: WBGene00022737(tofu-7)
Availability: available
Source References: EMPTY
Synonyms: ZK418.8(ok2535) III.
Alternate IDs: WB-STRAIN:RB1932, CGC_RB1932
Notes: Made_by: OMRF Knockout Group|"This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use."|"ZK418.8 Homozygous. Outer Left Sequence: aaaaccggtgaagtttgagg. Outer Right Sequence: catttgcgaaatgggaaagt. Inner Left Sequence: ttttcgagctacaacgacttttt. Inner Right Sequence: attgcgagcccatttgttat. Inner Primer PCR Length: 3125. Deletion size: about 1100 bp."
Proper citation: RRID:WB-STRAIN:WBStrain00032617 Copy
http://www.wormbase.org/db/get?name=WBStrain00032613
Source Database: WormBase (WB)
Affected Genes: WBGene00013687(exoc-8)
Genomic Alteration: WBGene00013687(exoc-8)
Availability: available
Source References: PMID:38302462
Synonyms: exoc-8(ok2523) I.
Alternate IDs: WB-STRAIN:RB1928, CGC_RB1928
Notes: Made_by: OMRF Knockout Group|"This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use."|"Y105E8B.2. Homozygous. Outer Left Sequence: CTACCGACTGAGCTATCCGC. Outer Right Sequence: AAATTTCATGGCGTTTTTGG. Inner Left Sequence: TTTCGCAAAATGCACAACAT. Inner Right Sequence: GCCCCAGTCAACGTTAAAGA. Inner Primer PCR Length: 2583 bp. Deletion Size: 1474 bp. Deletion left flank: TTAAAAATGAACAAATTTTTTGGAAAATCT. Deletion right flank: TCACAGTTTGCCGTTTTCCTCGAATAGTTG."
Proper citation: RRID:WB-STRAIN:WBStrain00032613 Copy
http://www.wormbase.org/db/get?name=WBStrain00032612
Source Database: WormBase (WB)
Affected Genes: WBGene00008005(mip-1)
Genomic Alteration: WBGene00008005(mip-1)
Availability: available
Source References: EMPTY
Synonyms: C38D4.4(ok2513) III.
Alternate IDs: WB-STRAIN:RB1927, CGC_RB1927
Notes: C38D4.4. Homozygous. Outer Left Sequence: ACAAGAGGTGGAAGAGCCAA. Outer Right Sequence: CTATCCTTATCCGACGGCAA. Inner Left Sequence: AAGAAACGGCTGCGGTAATA. Inner Right Sequence: TGATAGCTTCTAGACACTCATTATC. Inner Primer PCR Length: 3063 bp. Deletion Size: 1751 bp. Deletion left flank: TATTTGTCCTTATTTATTTTATTATTTGAA. Deletion right flank: AATTGACCGAAATCTACGATAAGCATTTCG. Insertion Sequence: CCGA.|"Made_by: OMRF Knockout Group"|"This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use."
Proper citation: RRID:WB-STRAIN:WBStrain00032612 Copy
http://www.wormbase.org/db/get?name=WBStrain00032611
Source Database: WormBase (WB)
Affected Genes: WBGene00020163(T02G5.3)|WBGene00020169(mmaa-1)
Genomic Alteration: WBGene00020163(T02G5.3), WBGene00020169(mmaa-1)
Availability: available
Source References: EMPTY
Synonyms: T02G5.3&mmaa-1(ok2512) II.
Alternate IDs: WB-STRAIN:RB1926, CGC_RB1926
Notes: Made_by: OMRF Knockout Group|"T02G5.1, T02G5.13. Homozygous. Outer Left Sequence: TGATTGGTGCACTGGTCATT. Outer Right Sequence: AATCACGATACCTTGGACGC. Inner Left Sequence: TCGTTTCGAAATTCGTCCTC. Inner Right Sequence: ATGCCTGGTGACGACTACCT. Inner Primer PCR Length: 2798 bp. Deletion Size: 1381 bp. Deletion left flank: GTTTATACTCTGGAAAAAGTTACAAAATCA. Deletion right flank: GTGGGATCAATTGTTAAAACTGCAACTTTC."|"This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use."
Proper citation: RRID:WB-STRAIN:WBStrain00032611 Copy
http://www.wormbase.org/db/get?name=WBStrain00032699
Source Database: WormBase (WB)
Affected Genes: WBGene00013575(acs-5)
Genomic Alteration: WBGene00013575(acs-5)
Availability: available
Source References: EMPTY
Synonyms: acs-5(ok2668) III.
Alternate IDs: WB-STRAIN:RB2015, CGC_RB2015
Notes: Made_by: OMRF Knockout Group|"This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use."|"Y76A2B.3 Homozygous. Outer Left Sequence: aacaacacgttgctggagtg. Outer Right Sequence: ccacccatggcctaactcta. Inner Left Sequence: tctaatcgagttggattcacg. Inner Right Sequence: tgcaattacagggtcaacca. Inner Primer PCR Length: 3069. Deletion size: about 1700 bp."
Proper citation: RRID:WB-STRAIN:WBStrain00032699 Copy
http://www.wormbase.org/db/get?name=WBStrain00032610
Source Database: WormBase (WB)
Affected Genes: WBGene00008216(mec-19)
Genomic Alteration: WBGene00008216(mec-19)
Availability: available
Source References: EMPTY
Synonyms: C49G9.1(ok2504) I.
Alternate IDs: WB-STRAIN:RB1925, CGC_RB1925
Notes: C49G9.1. Homozygous. Outer Left Sequence: TTTTAAGCCATAACACCCGC. Outer Right Sequence: ATGCATCGACGAATACACCA. Inner Left Sequence: CCAGGAAATTGTCAACACGA. Inner Right Sequence: ATCCCTTCCTCCACATCTCA. Inner Primer PCR Length: 1210 bp. Deletion Size: 385 bp. Deletion left flank: TAAGGATTTGATAATTTCATGAAAATTAAA. Deletion right flank: ATCCAAATTTTTTTTTTCCAAAATTTTTTT.|"Made_by: OMRF Knockout Group"|"This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use."
Proper citation: RRID:WB-STRAIN:WBStrain00032610 Copy
http://www.wormbase.org/db/get?name=WBStrain00032619
Source Database: WormBase (WB)
Affected Genes: WBGene00021072(W07B8.4)
Genomic Alteration: WBGene00021072(W07B8.4)
Availability: available
Source References: EMPTY
Synonyms: W07B8.4(ok2537) V.
Alternate IDs: WB-STRAIN:RB1934, CGC_RB1934
Notes: Made_by: OMRF Knockout Group|"This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use."|"W07B8.4 Homozygous. Outer Left Sequence: caatggggtttcaaagcaat. Outer Right Sequence: gccgattttcagttagcctg. Inner Left Sequence: catgtattcctcgggattcg. Inner Right Sequence: ttcgctctgattcacttcca. Inner Primer PCR Length: 3069. Deletion size: about 1400 bp."
Proper citation: RRID:WB-STRAIN:WBStrain00032619 Copy
http://www.wormbase.org/db/get?name=WBStrain00032626
Source Database: WormBase (WB)
Affected Genes: WBGene00004319(rbr-2)
Genomic Alteration: WBGene00004319(rbr-2)
Availability: available
Source References: EMPTY
Synonyms: rbr-2(ok2544) IV.
Alternate IDs: WB-STRAIN:RB1941, CGC_RB1941
Notes: Made_by: OMRF Knockout Group|"This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use."|"ZK593.4. Homozygous. Outer Left Sequence: GAGGGGAAGATGAGTGTCCA. Outer Right Sequence: GCATGTCAGTGTTGATTCGG. Inner Left Sequence: TGCGTTGCTTGTAATGAAGG. Inner Right Sequence: TGAGCATGCTTCAAGACCAC. Inner Primer PCR Length: 3298 bp. Deletion Size: 1311 bp. Deletion left flank: CGAGTCGAGTAGGAAGTGGATTTCCTCGAA. Deletion right flank: GAGCAAAAGATGCTATCTATCGAGAACAAG."
Proper citation: RRID:WB-STRAIN:WBStrain00032626 Copy
http://www.wormbase.org/db/get?name=WBStrain00032624
Source Database: WormBase (WB)
Affected Genes: WBGene00016796(cec-2)
Genomic Alteration: WBGene00016796(cec-2)
Availability: available
Source References: EMPTY
Synonyms: C50A2.2(ok2542) IV.
Alternate IDs: WB-STRAIN:RB1939, CGC_RB1939
Notes: C50A2.2. Homozygous. Outer Left Sequence: AAAATCGTCGTCGAAACCTG. Outer Right Sequence: CTGACGCAAAATTGCAGAAA. Inner Left Sequence: ACAACGAACCGAGCCGAT. Inner Right Sequence: GTGCGTATTGGGAAGGTAGC. Inner Primer PCR Length: 3005 bp. Deletion Size: 1982 bp. Deletion left flank: ATTTAGTGTGACTAGGTTACTGTAGCACCA. Deletion right flank: CGTCAGATTGTGTTTACCAACAAAAAAAAT. Insertion Sequence: GACTTTTTTCTGCAATTTTG.|"Made_by: OMRF Knockout Group"|"This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use."
Proper citation: RRID:WB-STRAIN:WBStrain00032624 Copy
http://www.wormbase.org/db/get?name=WBStrain00032621
Source Database: WormBase (WB)
Affected Genes: WBGene00010895(M28.4)
Genomic Alteration: WBGene00010895(M28.4)
Availability: available
Source References: EMPTY
Synonyms: M28.4(ok2539) II.
Alternate IDs: WB-STRAIN:RB1936, CGC_RB1936
Notes: M28.4 Homozygous. Outer Left Sequence: agcgattccaaaatcactgg. Outer Right Sequence: tgcctggtaggcagaaaagt. Inner Left Sequence: cgctggattgttggttatca. Inner Right Sequence: gtcattggaattggaggtgg. Inner Primer PCR Length: 3023. Deletion size: about 2000 bp.|"Made_by: OMRF Knockout Group"|"This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use."
Proper citation: RRID:WB-STRAIN:WBStrain00032621 Copy
Can't find your Organism?
We recommend that you click next to the search bar to check some helpful tips on searches and refine your search firstly. If you want to find a specific organism, it's easier to enter an RRID or a Catalog Number to search. You can refine the search results using Facets on the left side of the search results page. If you are on the table view, you can also search in a specific column by clicking the column title and enter the keywords.
If you still could not find your organism in the search results, please help us by registering it into the system — it's easy. Organisms identifiers are registered through multiple sources depending on the species:
Welcome to the NIF Resources search. From here you can search through a compilation of resources used by NIF and see how data is organized within our community.
You are currently on the Community Resources tab looking through categories and sources that NIF has compiled. You can navigate through those categories from here or change to a different tab to execute your search through. Each tab gives a different perspective on data.
If you have an account on NIF then you can log in from here to get additional features in NIF such as Collections, Saved Searches, and managing Resources.
Here is the search term that is being executed, you can type in anything you want to search for. Some tips to help searching:
You can save any searches you perform for quick access to later from here.
We recognized your search term and included synonyms and inferred terms along side your term to help get the data you are looking for.
If you are logged into NIF you can add data records to your collections to create custom spreadsheets across multiple sources of data.
Here are the sources that were queried against in your search that you can investigate further.
Here are the categories present within NIF that you can filter your data on
Here are the subcategories present within this category that you can filter your data on
If you have any further questions please check out our FAQs Page to ask questions and see our tutorials. Click this button to view this tutorial again.