Searching the RRID Resource Information Network

Our searching services are busy right now. Please try again later

  • Register
X
Forgot Password

If you have forgotten your password you can enter your email here and get a temporary password sent to your email.

X

Leaving Community

Are you sure you want to leave this community? Leaving the community will revoke any permissions you have been granted in this community.

No
Yes

Preparing word cloud

×

Integrated Animals is a virtual database currently indexing available animal strains and mutants from: AGSC (Ambystoma), BCBC (mice), BDSC (flies), European Xenopus Resource Center (frog), The National Xenopus Resource (frog), Xenopus Express (frog), CWRU Cystic Fibrosis Mouse Models (mice), DGGR (flies), FlyBase (flies), IMSR (mice), MGI (mice), MMRRC (mice), NSRRC (pig), RGD (rats), Sperm Stem Cell Libraries for Biological Research (rats), Tetrahymena Stock Center (Tetrahymena), WormBase (worms), XGSC (Xiphophorus), ZFIN (zebrafish), and ZIRC (zebrafish). Note, the IMSR data is linked, but users may need to re-execute the search if the top mouse is not returned properly.
Note: BCBC is no longer in service, so the links may not be functional.

Suggested Search Criteria

Enter extra filters to help narrow your search

Search

Type in a keyword to search

Filter by records added date
See new records

Options


Current Facets and Filters

  • Database:WB (facet)

Facets


Recent searches

Snippet view Table view
Click the to add this resource to a Collection

64,152 Results - per page

Show More Columns | Download Top 1000 Results

Organism Name Proper Citation Species Synonyms Notes Phenotype Affected Gene Genomic Alteration Catalog Number Background Database Database Abbreviation Availability Source References Alternate IDs Record Last Update Mentions Count
ZK1058.3(hd7052[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP]) III.
 
Resource Report
Resource Website
RRID:WB-STRAIN:WBStrain00055631 Caenorhabditis elegans ZK1058.3(hd7052[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP]) III. Homozygous viable. Deletion of 1531 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Left flanking Sequence: TGAACAATCAATCTTAAATCCGCTTGCTCC; Right flanking sequence: CGCCGGAGATTGCTGCAAAAACGCTGAGCG. sgRNA #1: TTAAATCCGCTTGCTCCCGG; sgRNA #2: AAAACAACGGGATCTTTCGC. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.|"Made_by: VH KO group" WBGene00003514(myo-2)|WBGene00004496(rps-27)|WBGene00006789(unc-54) WBGene00003514(myo-2), WBGene00004496(rps-27), WBGene00006789(unc-54) WB-STRAIN:WBStrain00055631 WormBase (WB) WB unknown 2026-09-05 04:58:12 0
smg-4(az152) V.
 
Resource Report
Resource Website
RRID:WB-STRAIN:WBStrain00055592 Caenorhabditis elegans smg-4(az152) V. CRISPR/Cas9 engineered smg-4 null allele. smg-4(az152) allele is confirmed NMD-defective by both the presence of the protruding vulva phenotype and the accumulation of NMD-targeted isoforms. smg-4(az152) is easy to track in crosses by PCR and digestion with BstBI (see S1 text of Suzuki, et al. for sequence of allele) and essentially mimics ma116 in having a G->A mutation at the last base of intron 1. az152 also removes two bases of exon 2 and inserts 50nt in exon 2. Reference: Suzuki JMNGL, et al. PLoS Genet. 2022 Feb 10;18(2):e1010028. doi: 10.1371/journal.pgen.1010028. PMID: 35143478. WBGene00004882(smg-4) WBGene00004882(smg-4) WB-STRAIN:WBStrain00055592 WormBase (WB) WB unknown 2026-09-05 04:58:11 0
mce-1(ok243) I; rips-1(ij109) V.
 
Resource Report
Resource Website
RRID:WB-STRAIN:WBStrain00055595 Caenorhabditis elegans mce-1(ok243) I; rips-1(ij109) V. mce-1(D2030.5). Strong resistance to reducing agents dithiothreitol (DTT) and 2- mercaptoethanol (2ME). Reference: Winter AD, et al. BMC Biol. 2022 Oct 8;20(1):228. doi: 10.1186/s12915-022-01415-y. PMID:36209095 WBGene00008415(mce-1)|WBGene00019963(rips-1) WBGene00008415(mce-1), WBGene00019963(rips-1) WB-STRAIN:WBStrain00055595 WormBase (WB) WB unknown 2026-09-05 04:58:11 0
unc-73(az63) dxbp-1(az52) I; smg-4(az152) V.
 
Resource Report
Resource Website
RRID:WB-STRAIN:WBStrain00055594 Caenorhabditis elegans unc-73(az63) dxbp-1(az52) I; smg-4(az152) V. az52 is a CRISPR-engineered M107I missense allele of dxbp-1. az52 has no phenotype on its own, but suppresses unc-73(e936) and unc-73(az63) by promoting use of a cryptic splice site for an intron beginning with UU. smg-4(az152) provides an NMD deficient background allowing identification of out-of-frame mis-splicing in an RNA-seq experiment. Reference: Suzuki JMNGL, et al. PLoS Genet. 2022 Feb 10;18(2):e1010028. doi: 10.1371/journal.pgen.1010028. PMID: 35143478. WBGene00004882(smg-4)|WBGene00006805(unc-73)|WBGene00013128(dxbp-1) WBGene00004882(smg-4), WBGene00006805(unc-73), WBGene00013128(dxbp-1) WB-STRAIN:WBStrain00055594 WormBase (WB) WB unknown 2026-09-05 04:58:11 0
tmem-39(hd7057[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP]) I.
 
Resource Report
Resource Website
RRID:WB-STRAIN:WBStrain00055636 Caenorhabditis elegans tmem-39(hd7057[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP]) I. Homozygous viable. Deletion of 1785 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Left flanking Sequence: CAGTCAATCCGACGACAATTGCAAGTTGAC; Right flanking sequence: CGGAAGGAGCTTGTGGTGGAGGTGCCGGCA. sgRNA #1: ATTCCCATACCTCGTTGATG; sgRNA #2: TCTTGGGATTGAAGCTGGCA. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.|"Made_by: VH KO group" WBGene00003514(myo-2)|WBGene00004496(rps-27)|WBGene00006789(unc-54)|WBGene00017003(tmem-39) WBGene00003514(myo-2), WBGene00004496(rps-27), WBGene00006789(unc-54), WBGene00017003(tmem-39) WB-STRAIN:WBStrain00055636 WormBase (WB) WB unknown 2026-09-05 04:58:12 0
lgc-50(flv8) III; flvIs2.
 
Resource Report
Resource Website
RRID:WB-STRAIN:WBStrain00055585 Caenorhabditis elegans lgc-50(flv8) III; flvIs2. flvIs2 [tph-1p(short)::Chrimson + elt-2p::mCherry]. Deficits in serotonin-dependent slowing response. NSM neuron is expressing Chrimson and can be specifically activated by red light. Reference: Dag U, et al. bioRxiv 2023.01.15.524132; doi: https:|"Made_by: Ugur Dag" WBGene00020605(lgc-50) WBGene00020605(lgc-50) WB-STRAIN:WBStrain00055585 WormBase (WB) WB unknown 2026-09-05 04:58:11 0
mpz-6(hd7015[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP]) II.
 
Resource Report
Resource Website
RRID:WB-STRAIN:WBStrain00055621 Caenorhabditis elegans mpz-6(hd7015[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP]) II. Homozygous viable. Deletion of 1556 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Left flanking Sequence: CTTTGACATAGTGACACGCATTGGAAGCCG; Right flanking sequence: GGGAAACTCCGCCCACAAACGCTGAAAGTT. sgRNA #1: AACTATTTCAATGGTTCAGT; sgRNA #2: CCACACTCTCCGAGCAAGAT. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.|"Made_by: VH KO group" WBGene00003514(myo-2)|WBGene00004496(rps-27)|WBGene00006789(unc-54)|WBGene00013085(mpz-6) WBGene00003514(myo-2), WBGene00004496(rps-27), WBGene00006789(unc-54), WBGene00013085(mpz-6) WB-STRAIN:WBStrain00055621 WormBase (WB) WB unknown 2026-09-05 04:58:11 0
unc-73(e936) I; prp-8(az50) III.
 
Resource Report
Resource Website
RRID:WB-STRAIN:WBStrain00055587 Caenorhabditis elegans unc-73(e936) I; prp-8(az50) III. prp-8(az50) is a T524S missense allele that affects cryptic splicing (5'ss choice) of unc-73(e936) to allow more UNC-73 protein to be produced. PRP-8 is the largest protein in the spliceosome (essential) with a role in all stages of splicing. Reference: Mayerle M, et al. Proc Natl Acad Sci U S A. 2019 Feb 5;116(6):2193-2199. doi: 10.1073/pnas.1819020116. PMID: 30674666. WBGene00004187(prp-8)|WBGene00006805(unc-73) WBGene00004187(prp-8), WBGene00006805(unc-73) WB-STRAIN:WBStrain00055587 WormBase (WB) WB unknown 2026-09-05 04:58:11 0
otIs670 V; lite-1(ce314) gur-3(ok2245) X; flvIs17.
 
Resource Report
Resource Website
RRID:WB-STRAIN:WBStrain00055582 Caenorhabditis elegans otIs670 V; lite-1(ce314) gur-3(ok2245) X; flvIs17. flvIs17 [tag-168::NLS::GCaMP7F + gcy-28.d::NLS::tagRFPt + ceh-36::NLS::tagRFPt + inx-1::tagRFPt + mod-1::tagRFPt + tph-1(short)::NLS::tagRFPt + gcy-5::NLS-;:tagRFPt + gcy-7::NLS::tagRFPt]. See description of strain OH15263 for full description of otIs670 NeuroPAL (Neuronal Polychromatic Atlas of Landmarks) transgene (Yemini E, et al. Cell. 2021 Jan 7;184(1):272-288.e11. PMID: 33378642). This strain can be used for pan-neuronal calcium imaging. Back-crossed 5x to MT21793 after transgene integration. Reference: Dag U, et al. bioRxiv 2023.01.15.524132; doi: https:|"Made_by: Steve Flavell" WBGene00001803(lite-1)|WBGene00001804(gur-3) WBGene00001803(lite-1), WBGene00001804(gur-3) WB-STRAIN:WBStrain00055582 WormBase (WB) WB unknown 2026-09-05 04:58:11 0
gst-3(hd7048[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP]) IV.
 
Resource Report
Resource Website
RRID:WB-STRAIN:WBStrain00055627 Caenorhabditis elegans gst-3(hd7048[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP]) IV. Homozygous viable. Deletion of 724 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Left flanking Sequence: CTTTTAAAAGTTTATCGTTTTCAATATCCA; Right flanking sequence: TGGAGCAACTGGCCAGATGCACACTTATCT. sgRNA #1: GTTGATTAATGCCGAGTTGT; sgRNA #2: GCTCAGGAGACACAGACAGT. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.|"Made_by: VH KO group" WBGene00001751(gst-3)|WBGene00003514(myo-2)|WBGene00004496(rps-27)|WBGene00006789(unc-54) WBGene00001751(gst-3), WBGene00003514(myo-2), WBGene00004496(rps-27), WBGene00006789(unc-54) WB-STRAIN:WBStrain00055627 WormBase (WB) WB unknown 2026-09-05 04:58:12 0
gst-15(hd7047[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP]) II.
 
Resource Report
Resource Website
RRID:WB-STRAIN:WBStrain00055626 Caenorhabditis elegans gst-15(hd7047[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP]) II. Homozygous viable. Deletion of 2693 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Left flanking Sequence: TTGCTCTTTTTGAGAATTCGATTGAGAAGA; Right flanking sequence: GACATTTCGGCGGCAGTCAACATTAATGAA. sgRNA #1: ATAAAGTAGACATCTCGAGC; sgRNA #2: CTTGTCAATACTCTCTCACG. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.|"Made_by: VH KO group" WBGene00001763(gst-15)|WBGene00003514(myo-2)|WBGene00004496(rps-27)|WBGene00006789(unc-54) WBGene00001763(gst-15), WBGene00003514(myo-2), WBGene00004496(rps-27), WBGene00006789(unc-54) WB-STRAIN:WBStrain00055626 WormBase (WB) WB unknown 2026-09-05 04:58:12 0
unc-73(e936) I; prp-8(az117) III.
 
Resource Report
Resource Website
RRID:WB-STRAIN:WBStrain00055589 Caenorhabditis elegans unc-73(e936) I; prp-8(az117) III. prp-8(az117) is a CRISPR-engineered R540K missense allele that suppress unc-73(e936) uncoordination through activation of an in-frame cryptic 5'ss. Reference: Cartwright-Acar CH, et al. Nucleic Acids Res. 2022 Nov 11;50(20):11834-11857. doi: 10.1093/nar/gkac991. PMID: 36321655. WBGene00004187(prp-8)|WBGene00006805(unc-73) WBGene00004187(prp-8), WBGene00006805(unc-73) WB-STRAIN:WBStrain00055589 WormBase (WB) WB unknown 2026-09-05 04:58:11 0
mpz-5(hd7014[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP]) IV.
 
Resource Report
Resource Website
RRID:WB-STRAIN:WBStrain00055622 Caenorhabditis elegans mpz-5(hd7014[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP]) IV. Homozygous viable. Deletion of 1364 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Left flanking Sequence: AAATAAGAAAGTTTTTTTTTTAATTTTTAA; Right flanking sequence: ATGCCCGTTGCCATGCCGTTGTTCCGATAG. sgRNA #1: AAAGCTGTCTCACAAAGTAA; sgRNA #2: GAGGAGGAAAGGAATTAGGG. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.|"Made_by: VH KO group" WBGene00003514(myo-2)|WBGene00004496(rps-27)|WBGene00006789(unc-54)|WBGene00011241(mpz-5) WBGene00003514(myo-2), WBGene00004496(rps-27), WBGene00006789(unc-54), WBGene00011241(mpz-5) WB-STRAIN:WBStrain00055622 WormBase (WB) WB unknown 2026-09-05 04:58:11 0
ubc-1(hd7046[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP]) IV.
 
Resource Report
Resource Website
RRID:WB-STRAIN:WBStrain00055625 Caenorhabditis elegans ubc-1(hd7046[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP]) IV. Homozygous viable. Deletion of 2049 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Left flanking Sequence: AGGAGTTAGGTTATCAATATGACGACGCCC; Right flanking sequence: TGGAAATTGAAGAAATTGCTGCTCCAGGAG. sgRNA #1: CTCATCAAACGTCTACGGCT; sgRNA #2: CGCAGTGCTCAAGGATGACG. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.|"Made_by: VH KO group" WBGene00003514(myo-2)|WBGene00004496(rps-27)|WBGene00006701(ubc-1)|WBGene00006789(unc-54) WBGene00003514(myo-2), WBGene00004496(rps-27), WBGene00006701(ubc-1), WBGene00006789(unc-54) WB-STRAIN:WBStrain00055625 WormBase (WB) WB unknown 2026-09-05 04:58:12 0
cal-3(hd7045[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP]) IV.
 
Resource Report
Resource Website
RRID:WB-STRAIN:WBStrain00055624 Caenorhabditis elegans cal-3(hd7045[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP]) IV. Homozygous viable. Deletion of 6270 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Left flanking Sequence: AACGTACGTTATACGTAATAGAAGCACGTG; Right flanking sequence: CTCGGGGCGAATTCAAATAAAGATGCGGCT. sgRNA #1: CGTAATAGAAGCACGTGAGA; sgRNA #2: CGCAATTTGATCACACTCTC. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.|"Made_by: VH KO group" WBGene00000287(cal-3)|WBGene00003514(myo-2)|WBGene00004496(rps-27)|WBGene00006789(unc-54) WBGene00000287(cal-3), WBGene00003514(myo-2), WBGene00004496(rps-27), WBGene00006789(unc-54) WB-STRAIN:WBStrain00055624 WormBase (WB) WB unknown 2026-09-05 04:58:11 0
unc-73(e936) I; snrp-200(az123) II.
 
Resource Report
Resource Website
RRID:WB-STRAIN:WBStrain00055591 Caenorhabditis elegans unc-73(e936) I; snrp-200(az123) II. az123 is an N18K missense allele altering 5' cryptic splicing usage. az123 is a CRISPR-induced mutation mimicking a known suppressor of unc-73(e936). Reference: Cartwright-Acar CH, et al. Nucleic Acids Res. 2022 Nov 11;50(20):11834-11857. doi: 10.1093/nar/gkac991. PMID: 36321655. WBGene00006805(unc-73)|WBGene00012896(snrp-200) WBGene00006805(unc-73), WBGene00012896(snrp-200) WB-STRAIN:WBStrain00055591 WormBase (WB) WB unknown 2026-09-05 04:58:11 0
unc-49(e407) III; hpIs592; ljIs131.
 
Resource Report
Resource Website
RRID:WB-STRAIN:WBStrain00055691 Caenorhabditis elegans unc-49(e407) III; hpIs592; ljIs131. hpIs592 [ttr-39p::Chrimson::wCherry + lin-15(+)]. ljIs131 [myo-3p::GCaMP3::UrSL2::tagRFP-T]. Shrinker. Body relaxation upon green light illumination with ATR. Reference: Lu Y, et al. 2022. Current Biology (In Press). WBGene00006784(unc-49) WBGene00006784(unc-49) WB-STRAIN:WBStrain00055691 WormBase (WB) WB unknown 2026-09-05 04:58:12 0
unc-49(e407) III; gbb-2(tm1165) IV; hpIs592; ljIs131.
 
Resource Report
Resource Website
RRID:WB-STRAIN:WBStrain00055694 Caenorhabditis elegans unc-49(e407) III; gbb-2(tm1165) IV; hpIs592; ljIs131. hpIs592 [ttr-39p::Chrimson::wCherry + lin-15(+)]. ljIs131 [myo-3p::GCaMP3::UrSL2::tagRFP-T]. Shrinker. Red fluorescence in D motor neurons. Reference: Lu Y, et al. 2022. Current Biology (In Press). WBGene00006784(unc-49)|WBGene00022675(gbb-2) WBGene00006784(unc-49), WBGene00022675(gbb-2) WB-STRAIN:WBStrain00055694 WormBase (WB) WB unknown 2026-09-05 04:58:13 0
hpIs596; hpIs268.
 
Resource Report
Resource Website
RRID:WB-STRAIN:WBStrain00055699 Caenorhabditis elegans hpIs596; hpIs268. hpIs596 [acr-2(s)p::Chrimson::wCherry + lin-15(+)]. hpIs268 [unc-25p::GCaMP3si::SL2 wCherry + lin-15(+)]. Unc (linked to hpIs596). Green and red fluorescence in D-motor neurons. Very weak red fluorescence in A and B motorneurons. Reference: Lim MA, et al. eLife 2016;5:e19887. doi: 10.7554/eLife.19887. PMID: 27855782. WB-STRAIN:WBStrain00055699 WormBase (WB) WB unknown 2026-09-05 04:58:13 0
hpIs615; hpIs365.
 
Resource Report
Resource Website
RRID:WB-STRAIN:WBStrain00055732 Caenorhabditis elegans hpIs615; hpIs365. hpIs615 [acr-2(s)p::Arch::wCherry + lin-15(+)]. hpIs365 [unc-25p::GCaMP3::wCherry + lin-15(+)]. RFP expression in motor neurons. A and B motor neurons are inhibited and body relaxes upon illumination with green light. Reference: Lu Y, et al. 2022. Current Biology (In Press). WB-STRAIN:WBStrain00055732 WormBase (WB) WB unknown 2026-09-05 04:58:13 0

Can't find your Organism?

We recommend that you click next to the search bar to check some helpful tips on searches and refine your search firstly. If you want to find a specific organism, it's easier to enter an RRID or a Catalog Number to search. You can refine the search results using Facets on the left side of the search results page. If you are on the table view, you can also search in a specific column by clicking the column title and enter the keywords.

If you still could not find your organism in the search results, please help us by registering it into the system — it's easy. Organisms identifiers are registered through multiple sources depending on the species:

Can't find the RRID you're searching for? X
X
  1. Neuroscience Information Framework Resources

    Welcome to the NIF Resources search. From here you can search through a compilation of resources used by NIF and see how data is organized within our community.

  2. Navigation

    You are currently on the Community Resources tab looking through categories and sources that NIF has compiled. You can navigate through those categories from here or change to a different tab to execute your search through. Each tab gives a different perspective on data.

  3. Logging in and Registering

    If you have an account on NIF then you can log in from here to get additional features in NIF such as Collections, Saved Searches, and managing Resources.

  4. Searching

    Here is the search term that is being executed, you can type in anything you want to search for. Some tips to help searching:

    1. Use quotes around phrases you want to match exactly
    2. You can manually AND and OR terms to change how we search between words
    3. You can add "-" to terms to make sure no results return with that term in them (ex. Cerebellum -CA1)
    4. You can add "+" to terms to require they be in the data
    5. Using autocomplete specifies which branch of our semantics you with to search and can help refine your search
  5. Collections

    If you are logged into NIF you can add data records to your collections to create custom spreadsheets across multiple sources of data.

  6. Facets

    Here are the facets that you can filter the data by.

  7. Further Questions

    If you have any further questions please check out our FAQs Page to ask questions and see our tutorials. Click this button to view this tutorial again.