Searching the RRID Resource Information Network
Are you sure you want to leave this community? Leaving the community will revoke any permissions you have been granted in this community.
Integrated Animals is a virtual database currently indexing available animal strains and mutants from: AGSC (Ambystoma), BCBC (mice), BDSC (flies), European Xenopus Resource Center (frog), The National Xenopus Resource (frog), Xenopus Express (frog), CWRU Cystic Fibrosis Mouse Models (mice), DGGR (flies), FlyBase (flies), IMSR (mice), MGI (mice), MMRRC (mice), NSRRC (pig), RGD (rats), Sperm Stem Cell Libraries for Biological Research (rats), Tetrahymena Stock Center (Tetrahymena), WormBase (worms), XGSC (Xiphophorus), ZFIN (zebrafish), and ZIRC (zebrafish). Note, the IMSR data is linked, but users may need to re-execute the search if the top mouse is not returned properly.
Note: BCBC is no longer in service, so the links may not be functional.
http://www.wormbase.org/db/get?name=WBStrain00007080
Source Database: WormBase (WB)
Availability: available
Source References: EMPTY
Synonyms: oxTi999 V.
Alternate IDs: WB-STRAIN:EG8938, CGC_EG8938
Notes: oxTi999 [eft-3p::GFP::2xNLS::tbb-2 3'UTR + PuroR] V. Strain is healthy. NOTE: This strain is not necessarily homozygous - please verify before using. Nuclear green fluorescence is broadly expressed (in most cells) and visible under dissection microscope. This strain can be used for mapping or to facilitate genetic crosses. Integration site: (V:6.72). Intergenic insertion. Please see wormbuilder.org for exact insertion site. miniMos insertion of pCFJ1659 into N2 with puromycin selection.
Proper citation: RRID:WB-STRAIN:WBStrain00007080 Copy
http://www.wormbase.org/db/get?name=WBStrain00007131
Source Database: WormBase (WB)
Affected Genes: WBGene00003150(mbk-2)
Genomic Alteration: WBGene00003150(mbk-2)
Availability: available
Source References: EMPTY
Synonyms: cmEx6.
Alternate IDs: WB-STRAIN:EK123, CGC_EK123
Notes: cmEx6 [(pBR126) mbk-2p::GFP + rol-6(su1006)]. Maintain by picking Rollers.
Proper citation: RRID:WB-STRAIN:WBStrain00007131 Copy
http://www.wormbase.org/db/get?name=WBStrain00007130
Source Database: WormBase (WB)
Affected Genes: WBGene00001651(gon-2)|WBGene00008214(gem-1)
Genomic Alteration: WBGene00001651(gon-2), WBGene00008214(gem-1)
Availability: available
Source References: EMPTY
Synonyms: gon-2(q388) I; gem-1(bc364) X.
Alternate IDs: WB-STRAIN:EJ1171, CGC_EJ1171
Notes: NOTE: Supplement media to 50 mM Mg2+ and grow at 15C for maximum fertility. The stock will propagate on non-supplemented media at 20 degrees, but this will potentially select for intragenic revertants of gon-2(q388). Temperature-sensitive failure of gonad precursor divisions. Penetrance of Gon phenotype is very high at 23.5C. At 25 degrees you can expect reduced brood sizes and some embryonic lethality. [Note: temperature sensitive period for gon-2(q388) begins prior to fertilization.] bc364 deletes 1,109 bp between AACATCTTGAATAACCATTCGGGAAGT and AAGTCATTCATTGCAGAGCTTACATTTAGTA. References: Kemp BJ, et al. Genetics. 2009 Feb;181(2):581-91. Sun AY & Lambie EJ. Genetics. 1997 Nov;147(3):1077-89.
Proper citation: RRID:WB-STRAIN:WBStrain00007130 Copy
http://www.wormbase.org/db/get?name=WBStrain00007129
Source Database: WormBase (WB)
Affected Genes: WBGene00008214(gem-1)
Genomic Alteration: WBGene00008214(gem-1)
Availability: available
Source References: EMPTY
Synonyms: gem-1(bc364) X.
Alternate IDs: WB-STRAIN:EJ1167, CGC_EJ1167
Notes: bc364 deletes 1,109 bp between AACATCTTGAATAACCATTCGGGAAGT and AAGTCATTCATTGCAGAGCTTACATTTAGTA. References: Kemp BJ, et al. Genetics. 2009 Feb;181(2):581-91.
Proper citation: RRID:WB-STRAIN:WBStrain00007129 Copy
http://www.wormbase.org/db/get?name=WBStrain00007127
Source Database: WormBase (WB)
Affected Genes: WBGene00000254(bli-4)|WBGene00001077(dpy-18)|WBGene00001867(him-8)|WBGene00009119(ndk-1)
Genomic Alteration: WBGene00000254(bli-4), WBGene00001077(dpy-18), WBGene00001867(him-8), WBGene00009119(ndk-1)
Availability: available
Source References: EMPTY
Synonyms: F25H2.5(ok314)/hT2 [dpy-18(h662)] I; +/hT2 [bli-4(e937)] III; him-8(e1489) IV.
Alternate IDs: WB-STRAIN:EJ810, CGC_EJ810
Notes: Him. Heterozygotes are WT and segregate WT, Sterile Evul and Dpys.|"Mutagen:UV/TMP"
Proper citation: RRID:WB-STRAIN:WBStrain00007127 Copy
http://www.wormbase.org/db/get?name=WBStrain00007126
Source Database: WormBase (WB)
Affected Genes: WBGene00001577(gem-4)
Genomic Alteration: WBGene00001577(gem-4)
Availability: available
Source References: EMPTY
Synonyms: gem-4(dx77) IV.
Alternate IDs: WB-STRAIN:EJ808, CGC_EJ808
Notes: No apparent phenotype. Suppressor of gon-2(q388).
Proper citation: RRID:WB-STRAIN:WBStrain00007126 Copy
http://www.wormbase.org/db/get?name=WBStrain00007147
Source Database: WormBase (WB)
Affected Genes: WBGene00000254(bli-4)|WBGene00001077(dpy-18)|WBGene00001214(ego-1)|WBGene00006765(unc-29)
Genomic Alteration: WBGene00000254(bli-4), WBGene00001077(dpy-18), WBGene00001214(ego-1), WBGene00006765(unc-29)
Availability: available
Source References: PMID:8647392
Synonyms: ego-1(om71) unc-29(e193)/hT2 [dpy-18(h662)] I; +/hT2 [bli-4(e937)] III.
Alternate IDs: WB-STRAIN:EL302, CGC_EL302
Notes: Heterozygotes are WT and segregate WT, Sterile Uncs and Dpys. bli-4 is suppressed by dpy-18 in hT2 homozygotes-only see a very few DpyBli.
Proper citation: RRID:WB-STRAIN:WBStrain00007147 Copy
http://www.wormbase.org/db/get?name=WBStrain00007146
Source Database: WormBase (WB)
Affected Genes: WBGene00002245(lag-1)
Genomic Alteration: WBGene00002245(lag-1)
Availability: available
Source References: PMID:8647392
Synonyms: lag-1(om13) IV.
Alternate IDs: WB-STRAIN:EL301, CGC_EL301
Notes: Temperature sensitive; best grown at 15C. Lab and embryonic Mel phenotypes.
Proper citation: RRID:WB-STRAIN:WBStrain00007146 Copy
http://www.wormbase.org/db/get?name=WBStrain00007143
Source Database: WormBase (WB)
Affected Genes: WBGene00001216(ego-3)|WBGene00006808(unc-76)
Genomic Alteration: WBGene00001216(ego-3), WBGene00006808(unc-76)
Availability: available
Source References: PMID:8647392
Synonyms: ego-3(om40) unc-76(e911) V/nT1 [unc-?(n754) let-?] (IV;V).
Alternate IDs: WB-STRAIN:EL129, CGC_EL129
Notes: Heterozygotes are Unc and segregate additional hets, Unc-76 om40 homozygotes and dead eggs. om40 animals have multiple germline defects.
Proper citation: RRID:WB-STRAIN:WBStrain00007143 Copy
http://www.wormbase.org/db/get?name=WBStrain00007141
Source Database: WormBase (WB)
Affected Genes: WBGene00006843(unc-119)
Genomic Alteration: WBGene00006843(unc-119)
Availability: available
Source References: EMPTY
Synonyms: unc-119(ed3) III; cldIs5.
Alternate IDs: WB-STRAIN:EKM42, CGC_EKM42
Notes: cldIs5 [pie-1p::capg-1::GFP + unc-119(+)]. GFP tagged CAPG-1 driven by the pie-1 promoter; expression is detected in the germline and in embryos. References: Collette K, et al. J Cell Sci. 2011 Nov 1;124(Pt 21):3684-94. Bembenek JN, et al. Curr Biol. 2013 Jun 3;23(11):937-46.
Proper citation: RRID:WB-STRAIN:WBStrain00007141 Copy
http://www.wormbase.org/db/get?name=WBStrain00007140
Source Database: WormBase (WB)
Affected Genes: WBGene00019947(htz-1)
Genomic Alteration: WBGene00019947(htz-1)
Availability: available
Source References: EMPTY
Synonyms: htz-1(tm2469) IV/nT1 [qIs51] (IV;V).
Alternate IDs: WB-STRAIN:EKM11, CGC_EKM11
Notes: Made_by: G. Csankovszki|"Maintain under normal condition. Heterozygotes are WT with pharyngeal GFP signal, and segregate WT GFP, arrested nT1[qIs51] aneuploids, and non-GFP tm2469 homozygotes (Sterile). tm2469 m+z- are sterile adults. Homozygous nT1[qIs51] inviable. Pick WT GFP and check for correct segregation of progeny to maintain. Reference: Csankovszki G, et al. (2009) Curr Biol 19(1):9-19."|"Maintain under normal condition. Heterozygotes are WT with pharyngeal GFP signal, and segregate WT GFP, arrested nT1[qIs51] aneuploids, and non-GFP tm2469 homozygotes (Sterile). tm2469 m+z- are sterile adults. Homozygous nT1[qIs51] inviable. Pick WT GFP and check for correct segregation of progeny to maintain. Reference: Petty EL, et al. PLoS Genet. 2009 Oct;5(10):e1000699. doi: 10.1371/journal.pgen.1000699. Csankovszki G, et al. (2009) Curr Biol 19(1):9-19. [NOTE: new stock received at CGC 05/26/2021. Original stock received in 2010 had broken down and was no longer segregating as expected.]"|"Mutagen:TMP+UV"|"Mutagen:TMP/UV"|"No longer available from the CGC catalogue 24/04/2020"
Proper citation: RRID:WB-STRAIN:WBStrain00007140 Copy
http://www.wormbase.org/db/get?name=WBStrain00007157
Source Database: WormBase (WB)
Affected Genes: WBGene00001864(him-5)|WBGene00004301(ram-5)
Genomic Alteration: WBGene00001864(him-5), WBGene00004301(ram-5)
Availability: available
Source References: PMID:10899109
Synonyms: him-5(e1490) V; ram-5(bx30) X.
Alternate IDs: WB-STRAIN:EM81, CGC_EM81
Notes: Lumpy rays.|"Made_by: Baird S"
Proper citation: RRID:WB-STRAIN:WBStrain00007157 Copy
http://www.wormbase.org/db/get?name=WBStrain00007156
Source Database: WormBase (WB)
Affected Genes: WBGene00000611(col-34)|WBGene00001864(him-5)
Genomic Alteration: WBGene00000611(col-34), WBGene00001864(him-5)
Availability: available
Source References: EMPTY
Synonyms: col-34(bx25) IV; him-5(e1490) V.
Alternate IDs: WB-STRAIN:EM68, CGC_EM68
Notes: Lumpy rays. Temperature sensitive. bx25 previously called ram-4.|"Made_by: Baird S"
Proper citation: RRID:WB-STRAIN:WBStrain00007156 Copy
http://www.wormbase.org/db/get?name=WBStrain00007155
Source Database: WormBase (WB)
Affected Genes: WBGene00001864(him-5)|WBGene00003111(mab-20)
Genomic Alteration: WBGene00001864(him-5), WBGene00003111(mab-20)
Availability: available
Source References: PMID:1782863
Synonyms: mab-20(bx24) I; him-5(e1490) V.
Alternate IDs: WB-STRAIN:EM67, CGC_EM67
Notes: Extensive ray fusion. Posterior portion of body swollen at larval stages.
Proper citation: RRID:WB-STRAIN:WBStrain00007155 Copy
http://www.wormbase.org/db/get?name=WBStrain00007153
Source Database: WormBase (WB)
Affected Genes: WBGene00001864(him-5)|WBGene00003109(mab-17)|WBGene00006754(unc-15)
Genomic Alteration: WBGene00001864(him-5), WBGene00003109(mab-17), WBGene00006754(unc-15)
Availability: available
Source References: EMPTY
Synonyms: mab-17(e2167) unc-15(e73) I; him-5(e1490) V.
Alternate IDs: WB-STRAIN:EM62, CGC_EM62
Notes: Unc. Round bulging adult male tale. Very reduced fan. Mating efficiency is zero.
Proper citation: RRID:WB-STRAIN:WBStrain00007153 Copy
http://www.wormbase.org/db/get?name=WBStrain00007150
Source Database: WormBase (WB)
Affected Genes: WBGene00000254(bli-4)|WBGene00001077(dpy-18)|WBGene00001214(ego-1)|WBGene00006765(unc-29)
Genomic Alteration: WBGene00000254(bli-4), WBGene00001077(dpy-18), WBGene00001214(ego-1), WBGene00006765(unc-29)
Availability: available
Source References: PMID:10704412
Synonyms: ego-1(om84) unc-29(e193)/hT2 [dpy-18(h662)] I; +/hT2 [bli-4(e937)] III.
Alternate IDs: WB-STRAIN:EL391, CGC_EL391
Notes: Heterozygotes are WT and segregate WT, mild Unc that are Sterile, and Dpys. bli-4 is suppressed by dpy-18 in hT2 homozygotes-only see a very few DpyBli.|"Made_by: Spoerke/Maine"
Proper citation: RRID:WB-STRAIN:WBStrain00007150 Copy
http://www.wormbase.org/db/get?name=WBStrain00007149
Source Database: WormBase (WB)
Affected Genes: WBGene00000254(bli-4)|WBGene00001077(dpy-18)|WBGene00001214(ego-1)
Genomic Alteration: WBGene00000254(bli-4), WBGene00001077(dpy-18), WBGene00001214(ego-1)
Availability: available
Source References: EMPTY
Synonyms: ego-1(om58)/hT2 [dpy-18(h662)] I; +/hT2 [bli-4(e937)] III.
Alternate IDs: WB-STRAIN:EL329, CGC_EL329
Notes: Heterozgyotes are WT and segregate WT, Steriles and Dpys. The Steriles produce small, abnormal oocytes; some dead embryos are produced in late adulthood. bli-4 is suppressed by dpy-1 in hT2 homozygotes-only see a very few DpyBli. om58 previously called ego-6(om58).
Proper citation: RRID:WB-STRAIN:WBStrain00007149 Copy
http://www.wormbase.org/db/get?name=WBStrain00007168
Source Database: WormBase (WB)
Affected Genes: WBGene00001864(him-5)|WBGene00004299(ram-1)
Genomic Alteration: WBGene00001864(him-5), WBGene00004299(ram-1)
Availability: available
Source References: EMPTY
Synonyms: ram-1(bx34) I; him-5(e1490) V.
Alternate IDs: WB-STRAIN:EM139, CGC_EM139
Notes: Lumpy rays.|"Made_by: Baird S"
Proper citation: RRID:WB-STRAIN:WBStrain00007168 Copy
http://www.wormbase.org/db/get?name=WBStrain00007201
Source Database: WormBase (WB)
Availability: available
Source References: EMPTY
Synonyms: (kr5273) X.
Alternate IDs: WB-STRAIN:EN5273, CGC_EN5273
Notes: Mos1 transposon insertion in LG X. Presence of Mos1 can be detected using oligos oJL115 (Mos1 5'gctcaattcgcgccaaactatg3') and oVR266 (Chr X 5'gacaaagacgtgtagttgcg3'). Reference: Giordano-Santini R, et al., (2010) Nature Methods. Aug 22.
Proper citation: RRID:WB-STRAIN:WBStrain00007201 Copy
http://www.wormbase.org/db/get?name=WBStrain00007165
Source Database: WormBase (WB)
Affected Genes: WBGene00001068(dpy-6)|WBGene00001864(him-5)|WBGene00006757(unc-18)
Genomic Alteration: WBGene00001068(dpy-6), WBGene00001864(him-5), WBGene00006757(unc-18)
Availability: available
Source References: PMID:6537930
Synonyms: stDp2 (X;II)/+ II; him-5(e1490) V; unc-18(e81) dpy-6(e14) X.
Alternate IDs: WB-STRAIN:EM122, CGC_EM122
Notes: Strain throws WT, DpyUncs and males (and some Lon-don't know where these come from??). Maintain by picking WT. non-Unc non-Dpy males mate at low frequency and will transmit stDp2.
Proper citation: RRID:WB-STRAIN:WBStrain00007165 Copy
Can't find your Organism?
We recommend that you click next to the search bar to check some helpful tips on searches and refine your search firstly. If you want to find a specific organism, it's easier to enter an RRID or a Catalog Number to search. You can refine the search results using Facets on the left side of the search results page. If you are on the table view, you can also search in a specific column by clicking the column title and enter the keywords.
If you still could not find your organism in the search results, please help us by registering it into the system — it's easy. Organisms identifiers are registered through multiple sources depending on the species:
Welcome to the NIF Resources search. From here you can search through a compilation of resources used by NIF and see how data is organized within our community.
You are currently on the Community Resources tab looking through categories and sources that NIF has compiled. You can navigate through those categories from here or change to a different tab to execute your search through. Each tab gives a different perspective on data.
If you have an account on NIF then you can log in from here to get additional features in NIF such as Collections, Saved Searches, and managing Resources.
Here is the search term that is being executed, you can type in anything you want to search for. Some tips to help searching:
You can save any searches you perform for quick access to later from here.
We recognized your search term and included synonyms and inferred terms along side your term to help get the data you are looking for.
If you are logged into NIF you can add data records to your collections to create custom spreadsheets across multiple sources of data.
Here are the sources that were queried against in your search that you can investigate further.
Here are the categories present within NIF that you can filter your data on
Here are the subcategories present within this category that you can filter your data on
If you have any further questions please check out our FAQs Page to ask questions and see our tutorials. Click this button to view this tutorial again.
Welcome to the Neuroscience Information Framework Project, designed to serve the biomedical research community. NIF maintains the largest searchable collection of neuroscience data, the largest catalog of biomedical resources, and the largest ontology for neuroscience on the web. We welcome all feedback and suggestions and are actively looking for resource providers to make their resources accessible through NIF. Learn about the tools available to help you share your data and discover a dynamic inventory of Web-based neuroscience resources.
