Searching the RRID Resource Information Network
Are you sure you want to leave this community? Leaving the community will revoke any permissions you have been granted in this community.
Integrated Animals is a virtual database currently indexing available animal strains and mutants from: AGSC (Ambystoma), BCBC (mice), BDSC (flies), European Xenopus Resource Center (frog), The National Xenopus Resource (frog), Xenopus Express (frog), CWRU Cystic Fibrosis Mouse Models (mice), DGGR (flies), FlyBase (flies), IMSR (mice), MGI (mice), MMRRC (mice), NSRRC (pig), RGD (rats), Sperm Stem Cell Libraries for Biological Research (rats), Tetrahymena Stock Center (Tetrahymena), WormBase (worms), XGSC (Xiphophorus), ZFIN (zebrafish), and ZIRC (zebrafish). Note, the IMSR data is linked, but users may need to re-execute the search if the top mouse is not returned properly.
Note: BCBC is no longer in service, so the links may not be functional.
| Organism Name | Proper Citation | Species | Synonyms |
Notes |
Phenotype | Affected Gene | ||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
|
trEx1008. Resource Report Resource Website |
RRID:WB-STRAIN:WBStrain00055547 | Caenorhabditis elegans | trEx1008. | trEx1008 [idpa-3p::idpa-3::mNeonGreen + myo-2p::mCherry]. Pick animals with mCherry+ pharynx to maintain. Generated in N2 background. Reference: Kamal M, et al. bioRxiv 2022.03.11.483951; doi: https: | WB-STRAIN:WBStrain00055547 | WormBase (WB) | WB | unknown | 2026-08-01 10:24:45 | 0 | ||||||
|
bmdSi339 I; bmdSi297 II; arx-2(wy1814[arx-2::mIAA7::mNG]) qyIs225 V; lam-2(qy20[lam-2::mNG]) X. Resource Report Resource Website |
RRID:WB-STRAIN:WBStrain00055596 | Caenorhabditis elegans | bmdSi339 I; bmdSi297 II; arx-2(wy1814[arx-2::mIAA7::mNG]) qyIs225 V; lam-2(qy20[lam-2::mNG]) X. | bmdSi339 [loxN::lin-29p::FLP::p2A::H2B::2xmTurq2] I. bmdSi297 [loxN::rpl-28p::FRT3::STOP::FRT3::TIR1(F79G)::T2A::DHB::2xmKate2] II. qyIs225 [cdh-3p::mCherry::moeABD] V. mNG tags inserted into endogenous arx-2 and lam-2 loci. Wild-type growth and movement. Reference: Xiao Y, et al. Genetics. 2023 PMID: 36722258. | WBGene00000200(arx-2)|WBGene00016913(lam-2) | WBGene00000200(arx-2), WBGene00016913(lam-2) | WB-STRAIN:WBStrain00055596 | WormBase (WB) | WB | unknown | 2026-08-01 10:24:45 | 0 | ||||
|
ZK1058.3(hd7052[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP]) III. Resource Report Resource Website |
RRID:WB-STRAIN:WBStrain00055631 | Caenorhabditis elegans | ZK1058.3(hd7052[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP]) III. | Homozygous viable. Deletion of 1531 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Left flanking Sequence: TGAACAATCAATCTTAAATCCGCTTGCTCC; Right flanking sequence: CGCCGGAGATTGCTGCAAAAACGCTGAGCG. sgRNA #1: TTAAATCCGCTTGCTCCCGG; sgRNA #2: AAAACAACGGGATCTTTCGC. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.|"Made_by: VH KO group" | WBGene00003514(myo-2)|WBGene00004496(rps-27)|WBGene00006789(unc-54) | WBGene00003514(myo-2), WBGene00004496(rps-27), WBGene00006789(unc-54) | WB-STRAIN:WBStrain00055631 | WormBase (WB) | WB | unknown | 2026-08-01 10:24:46 | 0 | ||||
|
smg-4(az152) V. Resource Report Resource Website |
RRID:WB-STRAIN:WBStrain00055592 | Caenorhabditis elegans | smg-4(az152) V. | CRISPR/Cas9 engineered smg-4 null allele. smg-4(az152) allele is confirmed NMD-defective by both the presence of the protruding vulva phenotype and the accumulation of NMD-targeted isoforms. smg-4(az152) is easy to track in crosses by PCR and digestion with BstBI (see S1 text of Suzuki, et al. for sequence of allele) and essentially mimics ma116 in having a G->A mutation at the last base of intron 1. az152 also removes two bases of exon 2 and inserts 50nt in exon 2. Reference: Suzuki JMNGL, et al. PLoS Genet. 2022 Feb 10;18(2):e1010028. doi: 10.1371/journal.pgen.1010028. PMID: 35143478. | WBGene00004882(smg-4) | WBGene00004882(smg-4) | WB-STRAIN:WBStrain00055592 | WormBase (WB) | WB | unknown | 2026-08-01 10:24:45 | 0 | ||||
|
mce-1(ok243) I; rips-1(ij109) V. Resource Report Resource Website |
RRID:WB-STRAIN:WBStrain00055595 | Caenorhabditis elegans | mce-1(ok243) I; rips-1(ij109) V. | mce-1(D2030.5). Strong resistance to reducing agents dithiothreitol (DTT) and 2- mercaptoethanol (2ME). Reference: Winter AD, et al. BMC Biol. 2022 Oct 8;20(1):228. doi: 10.1186/s12915-022-01415-y. PMID:36209095 | WBGene00008415(mce-1)|WBGene00019963(rips-1) | WBGene00008415(mce-1), WBGene00019963(rips-1) | WB-STRAIN:WBStrain00055595 | WormBase (WB) | WB | unknown | 2026-08-01 10:24:45 | 0 | ||||
|
unc-73(az63) dxbp-1(az52) I; smg-4(az152) V. Resource Report Resource Website |
RRID:WB-STRAIN:WBStrain00055594 | Caenorhabditis elegans | unc-73(az63) dxbp-1(az52) I; smg-4(az152) V. | az52 is a CRISPR-engineered M107I missense allele of dxbp-1. az52 has no phenotype on its own, but suppresses unc-73(e936) and unc-73(az63) by promoting use of a cryptic splice site for an intron beginning with UU. smg-4(az152) provides an NMD deficient background allowing identification of out-of-frame mis-splicing in an RNA-seq experiment. Reference: Suzuki JMNGL, et al. PLoS Genet. 2022 Feb 10;18(2):e1010028. doi: 10.1371/journal.pgen.1010028. PMID: 35143478. | WBGene00004882(smg-4)|WBGene00006805(unc-73)|WBGene00013128(dxbp-1) | WBGene00004882(smg-4), WBGene00006805(unc-73), WBGene00013128(dxbp-1) | WB-STRAIN:WBStrain00055594 | WormBase (WB) | WB | unknown | 2026-08-01 10:24:48 | 0 | ||||
|
tmem-39(hd7057[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP]) I. Resource Report Resource Website |
RRID:WB-STRAIN:WBStrain00055636 | Caenorhabditis elegans | tmem-39(hd7057[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP]) I. | Homozygous viable. Deletion of 1785 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Left flanking Sequence: CAGTCAATCCGACGACAATTGCAAGTTGAC; Right flanking sequence: CGGAAGGAGCTTGTGGTGGAGGTGCCGGCA. sgRNA #1: ATTCCCATACCTCGTTGATG; sgRNA #2: TCTTGGGATTGAAGCTGGCA. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.|"Made_by: VH KO group" | WBGene00003514(myo-2)|WBGene00004496(rps-27)|WBGene00006789(unc-54)|WBGene00017003(tmem-39) | WBGene00003514(myo-2), WBGene00004496(rps-27), WBGene00006789(unc-54), WBGene00017003(tmem-39) | WB-STRAIN:WBStrain00055636 | WormBase (WB) | WB | unknown | 2026-08-01 10:24:48 | 0 | ||||
|
lgc-50(flv8) III; flvIs2. Resource Report Resource Website |
RRID:WB-STRAIN:WBStrain00055585 | Caenorhabditis elegans | lgc-50(flv8) III; flvIs2. | flvIs2 [tph-1p(short)::Chrimson + elt-2p::mCherry]. Deficits in serotonin-dependent slowing response. NSM neuron is expressing Chrimson and can be specifically activated by red light. Reference: Dag U, et al. bioRxiv 2023.01.15.524132; doi: https:|"Made_by: Ugur Dag" | WBGene00020605(lgc-50) | WBGene00020605(lgc-50) | WB-STRAIN:WBStrain00055585 | WormBase (WB) | WB | unknown | 2026-08-01 10:24:48 | 0 | ||||
|
mpz-6(hd7015[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP]) II. Resource Report Resource Website |
RRID:WB-STRAIN:WBStrain00055621 | Caenorhabditis elegans | mpz-6(hd7015[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP]) II. | Homozygous viable. Deletion of 1556 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Left flanking Sequence: CTTTGACATAGTGACACGCATTGGAAGCCG; Right flanking sequence: GGGAAACTCCGCCCACAAACGCTGAAAGTT. sgRNA #1: AACTATTTCAATGGTTCAGT; sgRNA #2: CCACACTCTCCGAGCAAGAT. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.|"Made_by: VH KO group" | WBGene00003514(myo-2)|WBGene00004496(rps-27)|WBGene00006789(unc-54)|WBGene00013085(mpz-6) | WBGene00003514(myo-2), WBGene00004496(rps-27), WBGene00006789(unc-54), WBGene00013085(mpz-6) | WB-STRAIN:WBStrain00055621 | WormBase (WB) | WB | unknown | 2026-08-01 10:24:48 | 0 | ||||
|
unc-73(e936) I; prp-8(az50) III. Resource Report Resource Website |
RRID:WB-STRAIN:WBStrain00055587 | Caenorhabditis elegans | unc-73(e936) I; prp-8(az50) III. | prp-8(az50) is a T524S missense allele that affects cryptic splicing (5'ss choice) of unc-73(e936) to allow more UNC-73 protein to be produced. PRP-8 is the largest protein in the spliceosome (essential) with a role in all stages of splicing. Reference: Mayerle M, et al. Proc Natl Acad Sci U S A. 2019 Feb 5;116(6):2193-2199. doi: 10.1073/pnas.1819020116. PMID: 30674666. | WBGene00004187(prp-8)|WBGene00006805(unc-73) | WBGene00004187(prp-8), WBGene00006805(unc-73) | WB-STRAIN:WBStrain00055587 | WormBase (WB) | WB | unknown | 2026-08-01 10:24:45 | 0 | ||||
|
otIs670 V; lite-1(ce314) gur-3(ok2245) X; flvIs17. Resource Report Resource Website |
RRID:WB-STRAIN:WBStrain00055582 | Caenorhabditis elegans | otIs670 V; lite-1(ce314) gur-3(ok2245) X; flvIs17. | flvIs17 [tag-168::NLS::GCaMP7F + gcy-28.d::NLS::tagRFPt + ceh-36::NLS::tagRFPt + inx-1::tagRFPt + mod-1::tagRFPt + tph-1(short)::NLS::tagRFPt + gcy-5::NLS-;:tagRFPt + gcy-7::NLS::tagRFPt]. See description of strain OH15263 for full description of otIs670 NeuroPAL (Neuronal Polychromatic Atlas of Landmarks) transgene (Yemini E, et al. Cell. 2021 Jan 7;184(1):272-288.e11. PMID: 33378642). This strain can be used for pan-neuronal calcium imaging. Back-crossed 5x to MT21793 after transgene integration. Reference: Dag U, et al. bioRxiv 2023.01.15.524132; doi: https:|"Made_by: Steve Flavell" | WBGene00001803(lite-1)|WBGene00001804(gur-3) | WBGene00001803(lite-1), WBGene00001804(gur-3) | WB-STRAIN:WBStrain00055582 | WormBase (WB) | WB | unknown | 2026-08-01 10:24:48 | 0 | ||||
|
gst-3(hd7048[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP]) IV. Resource Report Resource Website |
RRID:WB-STRAIN:WBStrain00055627 | Caenorhabditis elegans | gst-3(hd7048[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP]) IV. | Homozygous viable. Deletion of 724 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Left flanking Sequence: CTTTTAAAAGTTTATCGTTTTCAATATCCA; Right flanking sequence: TGGAGCAACTGGCCAGATGCACACTTATCT. sgRNA #1: GTTGATTAATGCCGAGTTGT; sgRNA #2: GCTCAGGAGACACAGACAGT. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.|"Made_by: VH KO group" | WBGene00001751(gst-3)|WBGene00003514(myo-2)|WBGene00004496(rps-27)|WBGene00006789(unc-54) | WBGene00001751(gst-3), WBGene00003514(myo-2), WBGene00004496(rps-27), WBGene00006789(unc-54) | WB-STRAIN:WBStrain00055627 | WormBase (WB) | WB | unknown | 2026-08-01 10:24:48 | 0 | ||||
|
gst-15(hd7047[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP]) II. Resource Report Resource Website |
RRID:WB-STRAIN:WBStrain00055626 | Caenorhabditis elegans | gst-15(hd7047[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP]) II. | Homozygous viable. Deletion of 2693 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Left flanking Sequence: TTGCTCTTTTTGAGAATTCGATTGAGAAGA; Right flanking sequence: GACATTTCGGCGGCAGTCAACATTAATGAA. sgRNA #1: ATAAAGTAGACATCTCGAGC; sgRNA #2: CTTGTCAATACTCTCTCACG. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.|"Made_by: VH KO group" | WBGene00001763(gst-15)|WBGene00003514(myo-2)|WBGene00004496(rps-27)|WBGene00006789(unc-54) | WBGene00001763(gst-15), WBGene00003514(myo-2), WBGene00004496(rps-27), WBGene00006789(unc-54) | WB-STRAIN:WBStrain00055626 | WormBase (WB) | WB | unknown | 2026-08-01 10:24:45 | 0 | ||||
|
unc-73(e936) I; prp-8(az117) III. Resource Report Resource Website |
RRID:WB-STRAIN:WBStrain00055589 | Caenorhabditis elegans | unc-73(e936) I; prp-8(az117) III. | prp-8(az117) is a CRISPR-engineered R540K missense allele that suppress unc-73(e936) uncoordination through activation of an in-frame cryptic 5'ss. Reference: Cartwright-Acar CH, et al. Nucleic Acids Res. 2022 Nov 11;50(20):11834-11857. doi: 10.1093/nar/gkac991. PMID: 36321655. | WBGene00004187(prp-8)|WBGene00006805(unc-73) | WBGene00004187(prp-8), WBGene00006805(unc-73) | WB-STRAIN:WBStrain00055589 | WormBase (WB) | WB | unknown | 2026-08-01 10:24:45 | 0 | ||||
|
mpz-5(hd7014[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP]) IV. Resource Report Resource Website |
RRID:WB-STRAIN:WBStrain00055622 | Caenorhabditis elegans | mpz-5(hd7014[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP]) IV. | Homozygous viable. Deletion of 1364 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Left flanking Sequence: AAATAAGAAAGTTTTTTTTTTAATTTTTAA; Right flanking sequence: ATGCCCGTTGCCATGCCGTTGTTCCGATAG. sgRNA #1: AAAGCTGTCTCACAAAGTAA; sgRNA #2: GAGGAGGAAAGGAATTAGGG. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.|"Made_by: VH KO group" | WBGene00003514(myo-2)|WBGene00004496(rps-27)|WBGene00006789(unc-54)|WBGene00011241(mpz-5) | WBGene00003514(myo-2), WBGene00004496(rps-27), WBGene00006789(unc-54), WBGene00011241(mpz-5) | WB-STRAIN:WBStrain00055622 | WormBase (WB) | WB | unknown | 2026-08-01 10:24:46 | 0 | ||||
|
ubc-1(hd7046[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP]) IV. Resource Report Resource Website |
RRID:WB-STRAIN:WBStrain00055625 | Caenorhabditis elegans | ubc-1(hd7046[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP]) IV. | Homozygous viable. Deletion of 2049 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Left flanking Sequence: AGGAGTTAGGTTATCAATATGACGACGCCC; Right flanking sequence: TGGAAATTGAAGAAATTGCTGCTCCAGGAG. sgRNA #1: CTCATCAAACGTCTACGGCT; sgRNA #2: CGCAGTGCTCAAGGATGACG. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.|"Made_by: VH KO group" | WBGene00003514(myo-2)|WBGene00004496(rps-27)|WBGene00006701(ubc-1)|WBGene00006789(unc-54) | WBGene00003514(myo-2), WBGene00004496(rps-27), WBGene00006701(ubc-1), WBGene00006789(unc-54) | WB-STRAIN:WBStrain00055625 | WormBase (WB) | WB | unknown | 2026-08-01 10:24:46 | 0 | ||||
|
cal-3(hd7045[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP]) IV. Resource Report Resource Website |
RRID:WB-STRAIN:WBStrain00055624 | Caenorhabditis elegans | cal-3(hd7045[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP]) IV. | Homozygous viable. Deletion of 6270 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Left flanking Sequence: AACGTACGTTATACGTAATAGAAGCACGTG; Right flanking sequence: CTCGGGGCGAATTCAAATAAAGATGCGGCT. sgRNA #1: CGTAATAGAAGCACGTGAGA; sgRNA #2: CGCAATTTGATCACACTCTC. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.|"Made_by: VH KO group" | WBGene00000287(cal-3)|WBGene00003514(myo-2)|WBGene00004496(rps-27)|WBGene00006789(unc-54) | WBGene00000287(cal-3), WBGene00003514(myo-2), WBGene00004496(rps-27), WBGene00006789(unc-54) | WB-STRAIN:WBStrain00055624 | WormBase (WB) | WB | unknown | 2026-08-01 10:24:48 | 0 | ||||
|
unc-73(e936) I; snrp-200(az123) II. Resource Report Resource Website |
RRID:WB-STRAIN:WBStrain00055591 | Caenorhabditis elegans | unc-73(e936) I; snrp-200(az123) II. | az123 is an N18K missense allele altering 5' cryptic splicing usage. az123 is a CRISPR-induced mutation mimicking a known suppressor of unc-73(e936). Reference: Cartwright-Acar CH, et al. Nucleic Acids Res. 2022 Nov 11;50(20):11834-11857. doi: 10.1093/nar/gkac991. PMID: 36321655. | WBGene00006805(unc-73)|WBGene00012896(snrp-200) | WBGene00006805(unc-73), WBGene00012896(snrp-200) | WB-STRAIN:WBStrain00055591 | WormBase (WB) | WB | unknown | 2026-08-01 10:24:48 | 0 | ||||
|
unc-49(e407) III; hpIs592; ljIs131. Resource Report Resource Website |
RRID:WB-STRAIN:WBStrain00055691 | Caenorhabditis elegans | unc-49(e407) III; hpIs592; ljIs131. | hpIs592 [ttr-39p::Chrimson::wCherry + lin-15(+)]. ljIs131 [myo-3p::GCaMP3::UrSL2::tagRFP-T]. Shrinker. Body relaxation upon green light illumination with ATR. Reference: Lu Y, et al. 2022. Current Biology (In Press). | WBGene00006784(unc-49) | WBGene00006784(unc-49) | WB-STRAIN:WBStrain00055691 | WormBase (WB) | WB | unknown | 2026-08-01 10:24:47 | 0 | ||||
|
unc-49(e407) III; gbb-2(tm1165) IV; hpIs592; ljIs131. Resource Report Resource Website |
RRID:WB-STRAIN:WBStrain00055694 | Caenorhabditis elegans | unc-49(e407) III; gbb-2(tm1165) IV; hpIs592; ljIs131. | hpIs592 [ttr-39p::Chrimson::wCherry + lin-15(+)]. ljIs131 [myo-3p::GCaMP3::UrSL2::tagRFP-T]. Shrinker. Red fluorescence in D motor neurons. Reference: Lu Y, et al. 2022. Current Biology (In Press). | WBGene00006784(unc-49)|WBGene00022675(gbb-2) | WBGene00006784(unc-49), WBGene00022675(gbb-2) | WB-STRAIN:WBStrain00055694 | WormBase (WB) | WB | unknown | 2026-08-01 10:24:47 | 0 |
Can't find your Organism?
We recommend that you click next to the search bar to check some helpful tips on searches and refine your search firstly. If you want to find a specific organism, it's easier to enter an RRID or a Catalog Number to search. You can refine the search results using Facets on the left side of the search results page. If you are on the table view, you can also search in a specific column by clicking the column title and enter the keywords.
If you still could not find your organism in the search results, please help us by registering it into the system — it's easy. Organisms identifiers are registered through multiple sources depending on the species:
Welcome to the NIF Resources search. From here you can search through a compilation of resources used by NIF and see how data is organized within our community.
You are currently on the Community Resources tab looking through categories and sources that NIF has compiled. You can navigate through those categories from here or change to a different tab to execute your search through. Each tab gives a different perspective on data.
If you have an account on NIF then you can log in from here to get additional features in NIF such as Collections, Saved Searches, and managing Resources.
Here is the search term that is being executed, you can type in anything you want to search for. Some tips to help searching:
If you are logged into NIF you can add data records to your collections to create custom spreadsheets across multiple sources of data.
Here are the facets that you can filter the data by.
If you have any further questions please check out our FAQs Page to ask questions and see our tutorials. Click this button to view this tutorial again.
Welcome to the Neuroscience Information Framework Project, designed to serve the biomedical research community. NIF maintains the largest searchable collection of neuroscience data, the largest catalog of biomedical resources, and the largest ontology for neuroscience on the web. We welcome all feedback and suggestions and are actively looking for resource providers to make their resources accessible through NIF. Learn about the tools available to help you share your data and discover a dynamic inventory of Web-based neuroscience resources.
