Searching the RRID Resource Information Network
Are you sure you want to leave this community? Leaving the community will revoke any permissions you have been granted in this community.
Integrated Animals is a virtual database currently indexing available animal strains and mutants from: AGSC (Ambystoma), BCBC (mice), BDSC (flies), European Xenopus Resource Center (frog), The National Xenopus Resource (frog), Xenopus Express (frog), CWRU Cystic Fibrosis Mouse Models (mice), DGGR (flies), FlyBase (flies), IMSR (mice), MGI (mice), MMRRC (mice), NSRRC (pig), RGD (rats), Sperm Stem Cell Libraries for Biological Research (rats), Tetrahymena Stock Center (Tetrahymena), WormBase (worms), XGSC (Xiphophorus), ZFIN (zebrafish), and ZIRC (zebrafish). Note, the IMSR data is linked, but users may need to re-execute the search if the top mouse is not returned properly.
Note: BCBC is no longer in service, so the links may not be functional.
| Organism Name | Proper Citation | Species | Synonyms |
Notes |
Phenotype | Affected Gene | ||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
|
Ctr-cat-1(ot1631[Ctr-cat-1::SL2::mScarlet3::H2B]) X. Resource Report Resource Website |
RRID:WB-STRAIN:WBStrain00062900 | Caenorhabditis tropicalis | Ctr-cat-1(ot1631[Ctr-cat-1::SL2::mScarlet3::H2B]) X. | Made_by: Itai Toker|"SL2::mScarlet3::H2B tag inserted before STOP codon of endogenous Ctr-cat-1 locus using CRISPR/Cas9. Generated in C. tropicalis NIC203 background. Reference: Toker IA, et al. bioRxiv 2024.11.23.624988; doi: https:" | WBGene00000295(cat-1) | WBGene00000295(cat-1) | WB-STRAIN:WBStrain00062900 | WormBase (WB) | WB | unknown | 2026-08-29 09:31:10 | 0 | ||||
|
ins-7(ot1427) IV. Resource Report Resource Website |
RRID:WB-STRAIN:WBStrain00062859 | Caenorhabditis elegans | ins-7(ot1427) IV. | ot1427 is CRISPR-engineered 1,007 bp deletion removing the entire ins-7 coding region. Sequence after edit: CTTCGAAGGATAACCCCGAAGAAGCTGTTCCAAAACATAATGGTGGCTCTTCTGGATTTTGGGTTCAATT. Reference: Sural S, et al. bioRxiv 2025.01.06.631508; doi: https: | WBGene00002090(ins-7) | WBGene00002090(ins-7) | WB-STRAIN:WBStrain00062859 | WormBase (WB) | WB | unknown | 2026-08-29 09:31:09 | 0 | ||||
|
cone-1(ot1409[*syb5437[GFP::con-1]) III. Resource Report Resource Website |
RRID:WB-STRAIN:WBStrain00062851 | Caenorhabditis elegans | cone-1(ot1409[*syb5437[GFP::con-1]) III. | Made_by: Michael Cesar|"syb5437 is a GFP tag inserted at the N-terminus of the endogenous cone-1 locus by CRISPR. ot1409 is a deletion removing exons 1-7 from the endogenously-tagged cone-1 locus. Broad punctate expression of GFP. Please contact Oliver Hobert prior to publishing work using this strain." | WBGene00306126(cone-1) | WBGene00306126(cone-1) | WB-STRAIN:WBStrain00062851 | WormBase (WB) | WB | unknown | 2026-08-29 09:31:09 | 0 | ||||
|
cone-1(ot1410[*syb5437[GFP::con-1]) III. Resource Report Resource Website |
RRID:WB-STRAIN:WBStrain00062852 | Caenorhabditis elegans | cone-1(ot1410[*syb5437[GFP::con-1]) III. | Made_by: Michael Cesar|"syb5437 is a GFP tag inserted at the N-terminus of the endogenous cone-1 locus by CRISPR. ot1410 is a deletion removing exon 5 from the endogenously-tagged cone-1 locus. Broad punctate expression of GFP. Please contact Oliver Hobert prior to publishing work using this strain." | WBGene00306126(cone-1) | WBGene00306126(cone-1) | WB-STRAIN:WBStrain00062852 | WormBase (WB) | WB | unknown | 2026-08-29 09:31:09 | 0 | ||||
|
otIs904 V. Resource Report Resource Website |
RRID:WB-STRAIN:WBStrain00062850 | Caenorhabditis elegans | otIs904 V. | otIs904 [ges-1p::ins-1::tagRFP-T::SL2::GFP::his-44::tbb-2 3 UTR + inx-6p18::tagRFP::unc-54 3' UTR] V. Transgene allows monitoring of the secretion of INS-1 neuropeptide from the intestine under different physiological conditions. The multicopy array was inserted at the oxTi553 landing site using the Fluorescent Landmark Interference (FLInt) method. Reference: Sural S, et al. bioRxiv 2025.01.06.631508; doi: https: | WB-STRAIN:WBStrain00062850 | WormBase (WB) | WB | unknown | 2026-08-29 09:31:09 | 0 | ||||||
|
Ctr-nlp-11(ot1422[Ctr-nlp-11::SL2::GFP::H2B]) II. Resource Report Resource Website |
RRID:WB-STRAIN:WBStrain00062856 | Caenorhabditis tropicalis | Ctr-nlp-11(ot1422[Ctr-nlp-11::SL2::GFP::H2B]) II. | Made_by: Itai Toker|"SL2::GFP::H2B tag inserted before STOP codon of endogenous Ctr-nlp-11 locus using CRISPR/Cas9. Generated in C. tropicalis NIC203 background. Reference: Toker IA, et al. bioRxiv 2024.11.23.624988; doi: https:" | WBGene00003749(nlp-11) | WBGene00003749(nlp-11) | WB-STRAIN:WBStrain00062856 | WormBase (WB) | WB | unknown | 2026-08-29 09:31:09 | 0 | ||||
|
col-105(syb6767[col-105::SL2::GFP::H2B]) him-8(e1489) IV. Resource Report Resource Website |
RRID:WB-STRAIN:WBStrain00062849 | Caenorhabditis elegans | col-105(syb6767[col-105::SL2::GFP::H2B]) him-8(e1489) IV. | Endogenous locus tagged with SL2::GFP::H2B at C-terminus using CRISPR/Cas9. The reporter is linked to him-8(e1489) in the background. Reference: Aguilar GR, et al. PLoS Biol. 2025 Jan 6;23(1):e3002979. doi: 10.1371/journal.pbio.3002979. PMID: 39761329|"Made_by: Robert Aguilar" | WBGene00000679(col-105)|WBGene00001867(him-8) | WBGene00000679(col-105), WBGene00001867(him-8) | WB-STRAIN:WBStrain00062849 | WormBase (WB) | WB | unknown | 2026-08-29 09:31:09 | 0 | ||||
|
Ctr-lim-6(ot1392[Ctr-lim-6::GFP]) X. Resource Report Resource Website |
RRID:WB-STRAIN:WBStrain00062846 | Caenorhabditis tropicalis | Ctr-lim-6(ot1392[Ctr-lim-6::GFP]) X. | C-terminal GFP tag inserted before STOP codon of endogenous Ctr-lim-6 locus using CRISPR/Cas9. Generated in C. tropicalis NIC203 background. Reference: Toker IA, et al. bioRxiv 2024.11.23.624988; doi: https:|"Made_by: Itai Toker" | WBGene00002988(lim-6) | WBGene00002988(lim-6) | WB-STRAIN:WBStrain00062846 | WormBase (WB) | WB | unknown | 2026-08-29 09:31:09 | 0 | ||||
|
him-5(e1490) V; otIs810. Resource Report Resource Website |
RRID:WB-STRAIN:WBStrain00062840 | Caenorhabditis elegans | him-5(e1490) V; otIs810. | Made_by: Cyril Cros|"otIs810 [sto-3p::tagRFP + sto-3p::GFP::cla-1]." | WBGene00001864(him-5) | WBGene00001864(him-5) | WB-STRAIN:WBStrain00062840 | WormBase (WB) | WB | unknown | 2026-08-29 09:31:08 | 0 | ||||
|
Cbr-eat-4(ot1371[Cbr-eat-4::T2A::GFP::H2B]) III. Resource Report Resource Website |
RRID:WB-STRAIN:WBStrain00062841 | Caenorhabditis briggsae | Cbr-eat-4(ot1371[Cbr-eat-4::T2A::GFP::H2B]) III. | Made_by: Itai Toker|"T2A::GFP::H2B tag inserted before STOP codon of endogenous Cbr-eat-4 locus using CRISPR/Cas9. Generated in C. briggsae AF16 background. Reference: Toker IA, et al. bioRxiv 2024.11.23.624988; doi: https:" | WBGene00001135(eat-4) | WBGene00001135(eat-4) | WB-STRAIN:WBStrain00062841 | WormBase (WB) | WB | unknown | 2026-08-29 09:31:09 | 0 | ||||
|
lim-6(ot1391[lim-6::GFP]) X. Resource Report Resource Website |
RRID:WB-STRAIN:WBStrain00062845 | Caenorhabditis elegans | lim-6(ot1391[lim-6::GFP]) X. | C-terminal GFP tag inserted before STOP codon of endogenous lim-6 locus using CRISPR/Cas9. Generated in N2 background. Reference: Toker IA, et al. bioRxiv 2024.11.23.624988; doi: https:|"Made_by: Itai Toker" | WBGene00002988(lim-6) | WBGene00002988(lim-6) | WB-STRAIN:WBStrain00062845 | WormBase (WB) | WB | unknown | 2026-08-29 09:31:09 | 0 | ||||
|
Cbr-unc-25(ot1373[Cbr-unc-25::T2A::GFP::H2B]) III. Resource Report Resource Website |
RRID:WB-STRAIN:WBStrain00062842 | Caenorhabditis briggsae | Cbr-unc-25(ot1373[Cbr-unc-25::T2A::GFP::H2B]) III. | Made_by: Itai Toker|"T2A::GFP::H2B tag inserted before STOP codon of endogenous Cbr-unc-25 locus using CRISPR/Cas9. Generated in C. briggsae AF16 background. Reference: Toker IA, et al. bioRxiv 2024.11.23.624988; doi: https:" | WBGene00006762(unc-25) | WBGene00006762(unc-25) | WB-STRAIN:WBStrain00062842 | WormBase (WB) | WB | unknown | 2026-08-29 09:31:09 | 0 | ||||
|
daf-16(ot971[daf-16::GFP]) I; ins-1(ot1360) IV. Resource Report Resource Website |
RRID:WB-STRAIN:WBStrain00062839 | Caenorhabditis elegans | daf-16(ot971[daf-16::GFP]) I; ins-1(ot1360) IV. | ot1360 is CRISPR-engineered 1,339 bp deletion removing the entire ins-1 coding region. Sequence after edit: TTATAGGGCATTTTTCAGTTCCTCACCGCTCTCAAATCAGGTCAATATCGTTGGCAGCTCACCGGACCCT. Reference: Sural S, et al. bioRxiv 2025.01.06.631508; doi: https: | WBGene00000912(daf-16)|WBGene00002084(ins-1) | WBGene00000912(daf-16), WBGene00002084(ins-1) | WB-STRAIN:WBStrain00062839 | WormBase (WB) | WB | unknown | 2026-08-29 09:31:09 | 0 | ||||
|
cdh-4(syb6764[cdh-4::GFP]) III. Resource Report Resource Website |
RRID:WB-STRAIN:WBStrain00062948 | Caenorhabditis elegans | cdh-4(syb6764[cdh-4::GFP]) III. | Made_by: SUNY Biotech|"SL2::GFP::H2B tag inserted at C-terminus of endogenous cdh-4 locus." | WBGene00000396(cdh-4) | WBGene00000396(cdh-4) | WB-STRAIN:WBStrain00062948 | WormBase (WB) | WB | unknown | 2026-08-29 09:31:11 | 0 | ||||
|
hlh-17 hlh-31(syb6635) IV. Resource Report Resource Website |
RRID:WB-STRAIN:WBStrain00062945 | Caenorhabditis elegans | hlh-17 hlh-31(syb6635) IV. | CRISPR/Cas9-engineered 5421 bp deletion entirely removing both hlh-17 and hlh-31. Reference: Aguilar GR, et al. PLoS Biol. 2025 Jan 6;23(1):e3002979. doi: 10.1371/journal.pbio.3002979. PMID: 39761329|"Made_by: SunyBiotech" | WBGene00001961(hlh-17)|WBGene00009540(hlh-31) | WBGene00001961(hlh-17), WBGene00009540(hlh-31) | WB-STRAIN:WBStrain00062945 | WormBase (WB) | WB | unknown | 2026-08-29 09:31:11 | 0 | ||||
|
hlh-17 hlh-31(syb6635) hlh-32(syb6773) IV. Resource Report Resource Website |
RRID:WB-STRAIN:WBStrain00062949 | Caenorhabditis elegans | hlh-17 hlh-31(syb6635) hlh-32(syb6773) IV. | Made_by: SunyBiotech|"Triple mutant for hlh-17, hlh-31, and hlh-32. CRISPR/Cas9-engineered 1691 bp deletion of the entire hlh-32 locus in hlh-17 hlh-31(syb6635) double mutant parental strain. Reference: Aguilar GR, et al. PLoS Biol. 2025 Jan 6;23(1):e3002979. doi: 10.1371/journal.pbio.3002979. PMID: 39761329" | WBGene00001961(hlh-17)|WBGene00009540(hlh-31)|WBGene00013665(hlh-32) | WBGene00001961(hlh-17), WBGene00009540(hlh-31), WBGene00013665(hlh-32) | WB-STRAIN:WBStrain00062949 | WormBase (WB) | WB | unknown | 2026-08-29 09:31:11 | 0 | ||||
|
hlh-32(syb6078[hlh-32::GFP]) IV. Resource Report Resource Website |
RRID:WB-STRAIN:WBStrain00062940 | Caenorhabditis elegans | hlh-32(syb6078[hlh-32::GFP]) IV. | Endogenous locus tagged with GFP at C-terminus using CRISPR/Cas9. Reference: Aguilar GR, et al. PLoS Biol. 2025 Jan 6;23(1):e3002979. doi: 10.1371/journal.pbio.3002979. PMID: 39761329|"Made_by: SunyBiotech" | WBGene00013665(hlh-32) | WBGene00013665(hlh-32) | WB-STRAIN:WBStrain00062940 | WormBase (WB) | WB | unknown | 2026-08-29 09:31:10 | 0 | ||||
|
ins-35(syb6236[ins-35::SL2::GFP::his-44]) V. Resource Report Resource Website |
RRID:WB-STRAIN:WBStrain00062943 | Caenorhabditis elegans | ins-35(syb6236[ins-35::SL2::GFP::his-44]) V. | Made_by: Suny Biotech|"SL2::GFP::HIS-44 tag inserted into the endogenous ins-35 locus. Reference: Sural S, et al. bioRxiv 2025.01.06.631508; doi: https:" | WBGene00001918(his-44)|WBGene00002118(ins-35) | WBGene00001918(his-44), WBGene00002118(ins-35) | WB-STRAIN:WBStrain00062943 | WormBase (WB) | WB | unknown | 2026-08-29 09:31:10 | 0 | ||||
|
hlh-17(syb6303[hlh-17::GFP]) IV. Resource Report Resource Website |
RRID:WB-STRAIN:WBStrain00062944 | Caenorhabditis elegans | hlh-17(syb6303[hlh-17::GFP]) IV. | Endogenous locus tagged with GFP at C-terminus using CRISPR/Cas9. Reference: Aguilar GR, et al. PLoS Biol. 2025 Jan 6;23(1):e3002979. doi: 10.1371/journal.pbio.3002979. PMID: 39761329|"Made_by: SunyBiotech" | WBGene00001961(hlh-17) | WBGene00001961(hlh-17) | WB-STRAIN:WBStrain00062944 | WormBase (WB) | WB | unknown | 2026-08-29 09:31:11 | 0 | ||||
|
hlh-31(syb6112[hlh-31::GFP]) IV. Resource Report Resource Website |
RRID:WB-STRAIN:WBStrain00062941 | Caenorhabditis elegans | hlh-31(syb6112[hlh-31::GFP]) IV. | Endogenous locus tagged with GFP at C-terminus using CRISPR/Cas9. Reference: Aguilar GR, et al. PLoS Biol. 2025 Jan 6;23(1):e3002979. doi: 10.1371/journal.pbio.3002979. PMID: 39761329|"Made_by: SunyBiotech" | WBGene00009540(hlh-31) | WBGene00009540(hlh-31) | WB-STRAIN:WBStrain00062941 | WormBase (WB) | WB | unknown | 2026-08-29 09:31:11 | 0 |
Can't find your Organism?
We recommend that you click next to the search bar to check some helpful tips on searches and refine your search firstly. If you want to find a specific organism, it's easier to enter an RRID or a Catalog Number to search. You can refine the search results using Facets on the left side of the search results page. If you are on the table view, you can also search in a specific column by clicking the column title and enter the keywords.
If you still could not find your organism in the search results, please help us by registering it into the system — it's easy. Organisms identifiers are registered through multiple sources depending on the species:
Welcome to the NIF Resources search. From here you can search through a compilation of resources used by NIF and see how data is organized within our community.
You are currently on the Community Resources tab looking through categories and sources that NIF has compiled. You can navigate through those categories from here or change to a different tab to execute your search through. Each tab gives a different perspective on data.
If you have an account on NIF then you can log in from here to get additional features in NIF such as Collections, Saved Searches, and managing Resources.
Here is the search term that is being executed, you can type in anything you want to search for. Some tips to help searching:
If you are logged into NIF you can add data records to your collections to create custom spreadsheets across multiple sources of data.
Here are the facets that you can filter the data by.
If you have any further questions please check out our FAQs Page to ask questions and see our tutorials. Click this button to view this tutorial again.
Welcome to the Neuroscience Information Framework Project, designed to serve the biomedical research community. NIF maintains the largest searchable collection of neuroscience data, the largest catalog of biomedical resources, and the largest ontology for neuroscience on the web. We welcome all feedback and suggestions and are actively looking for resource providers to make their resources accessible through NIF. Learn about the tools available to help you share your data and discover a dynamic inventory of Web-based neuroscience resources.
