Are you sure you want to leave this community? Leaving the community will revoke any permissions you have been granted in this community.
Integrated Animals is a virtual database currently indexing available animal strains and mutants from: AGSC (Ambystoma), BCBC (mice), BDSC (flies), European Xenopus Resource Center (frog), The National Xenopus Resource (frog), Xenopus Express (frog), CWRU Cystic Fibrosis Mouse Models (mice), DGGR (flies), FlyBase (flies), IMSR (mice), MGI (mice), MMRRC (mice), NSRRC (pig), RGD (rats), Sperm Stem Cell Libraries for Biological Research (rats), Tetrahymena Stock Center (Tetrahymena), WormBase (worms), XGSC (Xiphophorus), ZFIN (zebrafish), and ZIRC (zebrafish). Note, the IMSR data is linked, but users may need to re-execute the search if the top mouse is not returned properly.
Note: BCBC is no longer in service, so the links may not be functional.
http://www.wormbase.org/db/get?name=WBStrain00033212
Source Database: WormBase (WB)
Affected Genes: WBGene00011369(T02C12.4)
Genomic Alteration: WBGene00011369(T02C12.4)
Availability: available
Source References: EMPTY
Synonyms: T02C12.4(ok3518) III.
Alternate IDs: WB-STRAIN:RB2537, CGC_RB2537
Notes: Made_by: OMRF Knockout Group|"T02C12.4 Homozygous. Outer Left Sequence: gcgaaaggagcattcttcag. Outer Right Sequence: gaggaggaaaacgtggtgaa. Inner Left Sequence: aatttcttgatttcagccagc. Inner Right Sequence: caatggatcgaatggaacaa. Inner Primer PCR Length: 1189. Estimated Deletion Size: about 600 bp."|"This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use."
Proper citation: RRID:WB-STRAIN:WBStrain00033212 Copy
http://www.wormbase.org/db/get?name=WBStrain00033213
Source Database: WormBase (WB)
Affected Genes: WBGene00021548(trx-4)
Genomic Alteration: WBGene00021548(trx-4)
Availability: available
Source References: EMPTY
Synonyms: Y44E3A.3(ok3519) I.
Alternate IDs: WB-STRAIN:RB2538, CGC_RB2538
Notes: Made_by: OMRF Knockout Group|"This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use."|"Y44E3A.3 Homozygous. Outer Left Sequence: tatcgctgccacaattcaaa. Outer Right Sequence: acgcgaacgctaaaattctg. Inner Left Sequence: ccgtaaatcgacacaagtgc. Inner Right Sequence: gcgtattgagcaaaagacgaa. Inner Primer PCR Length: 1206. Estimated Deletion Size: about 300 bp."
Proper citation: RRID:WB-STRAIN:WBStrain00033213 Copy
http://www.wormbase.org/db/get?name=WBStrain00033304
Source Database: WormBase (WB)
Affected Genes: WBGene00001063(dpy-1)
Genomic Alteration: WBGene00001063(dpy-1)
Availability: available
Source References: EMPTY
Synonyms: dpy-1(ok5083) III.
Alternate IDs: WB-STRAIN:RB5000, CGC_RB5000
Notes: Made_by: OMRF KO Group|"This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use."|"Whole-genome sequenced strain. Dpy. It has not been confirmed that this phenotype is the result of ok5083. This strain was isolated after EMS mutagenesis of VC2010 and subjected to whole-genome sequencing (Flibotte et al., Genetics 185: 431 - 441 (2010). In addition to ok5083, it is homozygous for 196 other mutations determined from sequence data. All mutations are annotated in WormBase."
Proper citation: RRID:WB-STRAIN:WBStrain00033304 Copy
http://www.wormbase.org/db/get?name=WBStrain00033305
Source Database: WormBase (WB)
Availability: available
Source References: EMPTY
Synonyms: Whole-genome sequenced strain.
Alternate IDs: WB-STRAIN:RB5001, CGC_RB5001
Notes: Made_by: OMRF KO Group|"This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use."|"Whole-genome sequenced strain. Dpy. The mutation responsible for this phenotype has not been identified. This strain was isolated after EMS mutagenesis of VC2010 and subjected to whole-genome sequencing (Flibotte et al., Genetics 185: 431 - 441 (2010). It is homozygous for 289 mutations determined from sequence data, all of which are annotated in WormBase."
Proper citation: RRID:WB-STRAIN:WBStrain00033305 Copy
http://www.wormbase.org/db/get?name=WBStrain00033307
Source Database: WormBase (WB)
Affected Genes: WBGene00006843(unc-119)
Genomic Alteration: WBGene00006843(unc-119)
Availability: available
Source References: EMPTY
Synonyms: hutSi2642 II; unc-119(ed3) III.
Alternate IDs: WB-STRAIN:RBW2642, CGC_RBW2642
Notes: hutSi2642 [hsp-90p::mCherry::unc-54 3'UTR + Cbr-unc-119 (+)] II. Expresses a single copy of mCherry from hsp-90 promoter; construct utilizes the unc-54 terminator and 3'UTR. Can be used as a standard for multicolor imaging and quantitative microscopy. hsp-90 previously known as daf-21. Reference: Sands B, et al. 2018. Translational Medicine of Aging Volume 2, January 2018, Pages 110.
Proper citation: RRID:WB-STRAIN:WBStrain00033307 Copy
http://www.wormbase.org/db/get?name=WBStrain00033308
Source Database: WormBase (WB)
Affected Genes: WBGene00006843(unc-119)
Genomic Alteration: WBGene00006843(unc-119)
Availability: available
Source References: EMPTY
Synonyms: hutSi2661 II; unc-119(ed3) III
Alternate IDs: WB-STRAIN:RBW2661, CGC_RBW2661
Notes: hutSi2661 [hsp-90p::eGFPT::unc-54 3'UTR + Cbr-unc-119 (+)] II. Expresses a single copy of mEGFP from hsp-90 promoter; construct utilizes the unc-54 terminator and 3'UTR. Can be used as a standard for multicolor imaging and quantitative microscopy. hsp-90 previously known as daf-21. Reference: Sands B, et al. 2018. Translational Medicine of Aging Volume 2, January 2018, Pages 110.
Proper citation: RRID:WB-STRAIN:WBStrain00033308 Copy
http://www.wormbase.org/db/get?name=WBStrain00033309
Source Database: WormBase (WB)
Availability: available
Source References: PMID:9136008, PMID:9741632, PMID:18801967, PMID:18993077, PMID:31704915, PMID:33820969, PMID:38564369
Synonyms: Caenorhabditis elegans wild isolate.
Alternate IDs: WB-STRAIN:RC301, CGC_RC301
Notes: Reference WBG 9(3) 29 and 10(2) 140-141. npr-1 pka bor-1. Caenorhabditis elegans wild isolate (Tc1 pattern HCF).|"Reference WBPaper00058832 added based on published strain data identified by Textpresso literature search."
Proper citation: RRID:WB-STRAIN:WBStrain00033309 Copy
http://www.wormbase.org/db/get?name=WBStrain00033384
Source Database: WormBase (WB)
Affected Genes: WBGene00006777(unc-41)
Genomic Alteration: WBGene00006777(unc-41)
Availability: unknown
Source References: EMPTY
Synonyms: unc-41(md152) V.
Alternate IDs: WB-STRAIN:RM1677
Notes: unc-41(md152) is a 1 bp deletion after amino acid 872 in exon 8 producing GLHKS*. wt sequence: GCTAACTCTTGTGCAGCCCG. md152 sequence: GCTAACTCTTGTGCAGCCCA.
Proper citation: RRID:WB-STRAIN:WBStrain00033384 Copy
http://www.wormbase.org/db/get?name=WBStrain00033385
Source Database: WormBase (WB)
Affected Genes: WBGene00004367(ric-8)
Genomic Alteration: WBGene00004367(ric-8)
Availability: available
Source References: PMID:8901627
Synonyms: ric-8(md303) IV.
Alternate IDs: WB-STRAIN:RM1702, CGC_RM1702
Notes: Made_by: J. Rand/K. Miller|"Ric, Egl, severely locomotion defective, reduced body flexion/straight posture, pharyngeal pumping and growth rate slightly lower than WT. Does not reproduce at 25C. Brood size about 1/10 of WT at 20C, and about 1/3 of WT at 14C. 29% of eggs do not hatch. Early embryogenesis defects include misalignment of mitotic spindles and delayed migration of nuclei. Grows best at 14C but you can still work with it and do crosses at 20C."
Proper citation: RRID:WB-STRAIN:WBStrain00033385 Copy
http://www.wormbase.org/db/get?name=WBStrain00033387
Source Database: WormBase (WB)
Affected Genes: WBGene00000295(cat-1)
Genomic Alteration: WBGene00000295(cat-1)
Availability: available
Source References: EMPTY
Synonyms: cat-1(e1111) X.
Alternate IDs: WB-STRAIN:RM1845, CGC_RM1845
Notes: Catecholamine abnormal. See Duerr JS, et al. J Neurosci. 1999 Jan 1;19(1):72-84. for description of phenotypes.
Proper citation: RRID:WB-STRAIN:WBStrain00033387 Copy
http://www.wormbase.org/db/get?name=WBStrain00033389
Source Database: WormBase (WB)
Affected Genes: WBGene00000501(cho-1)|WBGene00006756(unc-17)
Genomic Alteration: WBGene00000501(cho-1), WBGene00006756(unc-17)
Availability: available
Source References: EMPTY
Synonyms: unc-17(e245) cho-1(tm373) IV.
Alternate IDs: WB-STRAIN:RM2037, CGC_RM2037
Notes: Loosely-linked (~12 cM apart) cholinergic mutants. Aldicarb-resistant, small, Unc-coily, slow-growing, slow pharyngeal pumping. cho-1(tm373) is a null deletion allele of the gene encoding the plasma membrane choline transporter, and unc-17(e245) is a strong missense allele of the synaptic vesicle acetylcholine transporter. References: Mullen GP, et al. Genetics. 2007 Sep;177(1):195-204.|"Made_by: Mai Vu"
Proper citation: RRID:WB-STRAIN:WBStrain00033389 Copy
http://www.wormbase.org/db/get?name=WBStrain00033392
Source Database: WormBase (WB)
Affected Genes: WBGene00006752(unc-13)
Genomic Alteration: WBGene00006752(unc-13)
Availability: available
Source References: PMID:36617680
Synonyms: unc-13(md2415)/hT1 I; +/hT1 V.
Alternate IDs: WB-STRAIN:RM2431, CGC_RM2431
Notes: Heterozygotes are WT and segregate WT, hT1 homozygotes (mid-larval lethals), md2415 homozygotes (generally L1 lethals which are almost completely paralyzed and have a coily posture with some head movement), and dead eggs. md2415 has a 2.7 kb deletion in the unc-13R region.|"Made_by: Moulder/Eustance-Koh"|"Mutagen: Psoralen"|"Supplementary_genotype unc-13(md2415)/hT1 I; +/hT1 V."
Proper citation: RRID:WB-STRAIN:WBStrain00033392 Copy
http://www.wormbase.org/db/get?name=WBStrain00033316
Source Database: WormBase (WB)
Affected Genes: WBGene00002147(ire-1)
Genomic Alteration: WBGene00002147(ire-1)
Availability: available
Source References: PMID:33542359, PMID:36924492, PMID:39436952
Synonyms: ire-1(v33) II.
Alternate IDs: WB-STRAIN:RE666, CGC_RE666
Notes: Made_by: X. Shen|"Slow growth. Abnormal tail."|"Supplementary_genotype ire-1(v33) II"
Proper citation: RRID:WB-STRAIN:WBStrain00033316 Copy
http://www.wormbase.org/db/get?name=WBStrain00033318
Source Database: WormBase (WB)
Affected Genes: WBGene00020286(gtsf-1)
Genomic Alteration: WBGene00020286(gtsf-1)
Availability: available
Source References: EMPTY
Synonyms: gtsf-1(xf43) IV.
Alternate IDs: WB-STRAIN:RFK607, CGC_RFK607
Notes: Eri, reduced brood size at 20C and sterility at 25C. Slightly Him. Reference: Almeida et al, 2018. The EMBO Journal, e99325.
Proper citation: RRID:WB-STRAIN:WBStrain00033318 Copy
http://www.wormbase.org/db/get?name=WBStrain00033319
Source Database: WormBase (WB)
Affected Genes: WBGene00020286(gtsf-1)
Genomic Alteration: WBGene00020286(gtsf-1)
Availability: available
Source References: EMPTY
Synonyms: gtsf-1(xf44) IV.
Alternate IDs: WB-STRAIN:RFK608, CGC_RFK608
Notes: Eri, reduced brood size at 20C and sterility at 25C. Slightly Him. Reference: Almeida et al, 2018. The EMBO Journal, e99325.
Proper citation: RRID:WB-STRAIN:WBStrain00033319 Copy
http://www.wormbase.org/db/get?name=WBStrain00033395
Source Database: WormBase (WB)
Affected Genes: WBGene00004910(snf-11)
Genomic Alteration: WBGene00004910(snf-11)
Availability: available
Source References: PMID:31415799
Synonyms: snf-11(ok156) V.
Alternate IDs: WB-STRAIN:RM2710, CGC_RM2710
Notes: Made_by: OMRF Knockout Group|"Mutagen:UV/TMP"|"No obvious phenotype."|"Superficially wild-type growth and behavior. unc-25-dependent aldicarb resistance. unc-25-dependent phenotypes are not rescued by exogenous GABA. Molecular details: 1491-bp deletion, removes exon 3, exon 4, and most of exon 5. Flanking sequences: AAAACTTCCACCAAGCACTT/ /AATTATATAACTATGTCACA Reference: Mullen GP, et al. Mol Biol Cell. 2006 Jul;17(7):3021-30."
Proper citation: RRID:WB-STRAIN:WBStrain00033395 Copy
http://www.wormbase.org/db/get?name=WBStrain00033396
Source Database: WormBase (WB)
Affected Genes: WBGene00004910(snf-11)|WBGene00006762(unc-25)
Genomic Alteration: WBGene00004910(snf-11), WBGene00006762(unc-25)
Availability: available
Source References: EMPTY
Synonyms: unc-25(e156) III; snf-11(ok156) V.
Alternate IDs: WB-STRAIN:RM2711, CGC_RM2711
Notes: Superficially similar to unc-25 mutants (Shrinker, Exp, etc.), except that unc-25-dependent behaviors are not rescued by exogenous GABA. Reference: Mullen GP, et al. Mol Biol Cell. 2006 Jul;17(7):3021-30.
Proper citation: RRID:WB-STRAIN:WBStrain00033396 Copy
http://www.wormbase.org/db/get?name=WBStrain00033310
Source Database: WormBase (WB)
Affected Genes: WBGene00001077(dpy-18)|WBGene00014228(mett-10)
Genomic Alteration: WBGene00001077(dpy-18), WBGene00014228(mett-10)
Availability: available
Source References: PMID:7250492
Synonyms: mett-10(g38) dpy-18(e364) III.
Alternate IDs: WB-STRAIN:RC399, CGC_RC399
Notes: Dpy. Maternal effect temperature sensitive embryonic lethal - leaky. Maintain at 15C. mett-10 was formerly known as let-42.
Proper citation: RRID:WB-STRAIN:WBStrain00033310 Copy
http://www.wormbase.org/db/get?name=WBStrain00033312
Source Database: WormBase (WB)
Availability: available
Source References: PMID:37651423, PMID:39525282
Synonyms: rdvIs1 III.
Alternate IDs: WB-STRAIN:RDV55, CGC_RDV55
Notes: rdvIs1 [egl-17p::Myri-mCherry::pie-1 3'UTR + egl-17p::mig-10::YFP::unc-54 3'UTR + egl-17p::mCherry-TEV-S::his-24 + rol-6(su1006)] III. Rollers, red fluorescence in vulvae. YFP cannot be detected. Maintain at 20C. Reference: Ou G, et al. Science. 2010 Oct 29;330(6004):677-80.|"Supplementary_genotype rdvIs1 [egl-17p::Myri-mCherry::pie-1 3'UTR + egl-17p::mig-10::YFP::unc-54 3'UTR + egl-17p::mCherry-TEV-S::his-24 + rol-6(su1006)] III"
Proper citation: RRID:WB-STRAIN:WBStrain00033312 Copy
http://www.wormbase.org/db/get?name=WBStrain00033369
Source Database: WormBase (WB)
Affected Genes: WBGene00001078(dpy-19)|WBGene00001609(glp-1)|WBGene00002845(let-711)|WBGene00003055(lon-1)|WBGene00006768(unc-32)
Genomic Alteration: WBGene00001078(dpy-19), WBGene00001609(glp-1), WBGene00002845(let-711), WBGene00003055(lon-1), WBGene00006768(unc-32)
Availability: available
Source References: EMPTY
Synonyms: lon-1(e185) let-711(it150) unc-32(e189)/qC1 [dpy-19(e1259) glp-1(q339)] III.
Alternate IDs: WB-STRAIN:RL67, CGC_RL67
Notes: Heterozygotes are WT and segregate WT, Dpy Steriles, and Lon Uncs which are temperature sensitive maternal effect lethals. Embryos from homozygyous it150 hermaphrodites have spindle orientation defects at second and third cleave at 25C.|"Made_by: L. DeBella/L. Rose"
Proper citation: RRID:WB-STRAIN:WBStrain00033369 Copy
Can't find your Organism?
We recommend that you click next to the search bar to check some helpful tips on searches and refine your search firstly. If you want to find a specific organism, it's easier to enter an RRID or a Catalog Number to search. You can refine the search results using Facets on the left side of the search results page. If you are on the table view, you can also search in a specific column by clicking the column title and enter the keywords.
If you still could not find your organism in the search results, please help us by registering it into the system — it's easy. Organisms identifiers are registered through multiple sources depending on the species:
Welcome to the NIF Resources search. From here you can search through a compilation of resources used by NIF and see how data is organized within our community.
You are currently on the Community Resources tab looking through categories and sources that NIF has compiled. You can navigate through those categories from here or change to a different tab to execute your search through. Each tab gives a different perspective on data.
If you have an account on NIF then you can log in from here to get additional features in NIF such as Collections, Saved Searches, and managing Resources.
Here is the search term that is being executed, you can type in anything you want to search for. Some tips to help searching:
You can save any searches you perform for quick access to later from here.
We recognized your search term and included synonyms and inferred terms along side your term to help get the data you are looking for.
If you are logged into NIF you can add data records to your collections to create custom spreadsheets across multiple sources of data.
Here are the sources that were queried against in your search that you can investigate further.
Here are the categories present within NIF that you can filter your data on
Here are the subcategories present within this category that you can filter your data on
If you have any further questions please check out our FAQs Page to ask questions and see our tutorials. Click this button to view this tutorial again.