Searching the RRID Resource Information Network
Are you sure you want to leave this community? Leaving the community will revoke any permissions you have been granted in this community.
Integrated Animals is a virtual database currently indexing available animal strains and mutants from: AGSC (Ambystoma), BCBC (mice), BDSC (flies), European Xenopus Resource Center (frog), The National Xenopus Resource (frog), Xenopus Express (frog), CWRU Cystic Fibrosis Mouse Models (mice), DGGR (flies), FlyBase (flies), IMSR (mice), MGI (mice), MMRRC (mice), NSRRC (pig), RGD (rats), Sperm Stem Cell Libraries for Biological Research (rats), Tetrahymena Stock Center (Tetrahymena), WormBase (worms), XGSC (Xiphophorus), ZFIN (zebrafish), and ZIRC (zebrafish). Note, the IMSR data is linked, but users may need to re-execute the search if the top mouse is not returned properly.
Note: BCBC is no longer in service, so the links may not be functional.
| Organism Name | Proper Citation | Species | Synonyms |
Notes |
Phenotype | Affected Gene | ||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
|
cshIs140 II; lin-12(ljf33[lin-12::mNeonGreen[C1]::loxP::3xFLAG::AID*]) III; lag-2(bmd202[lag-2::P2A::H2B::mTurquoise2::lox511i::2xHA]) V. Resource Report Resource Website 1+ mentions |
RRID:WB-STRAIN:WBStrain00062586 | Caenorhabditis elegans | cshIs140 II; lin-12(ljf33[lin-12::mNeonGreen[C1]::loxP::3xFLAG::AID*]) III; lag-2(bmd202[lag-2::P2A::H2B::mTurquoise2::lox511i::2xHA]) V. | cshIs140 [rpl-28p::TIR1(F79G)::T2A::mCherry::HIS-11] II. Allows for conditional degradation of endogenous LIN-12 using 5-Ph-IAA. Reference: Pani AM, et al. A new toolkit to visualize and perturb endogenous LIN-12/Notch signaling in C. elegans. MicroPubl Biol. 2022 Jul 28;2022:10.17912/micropub.biology.000603. doi: 10.17912/micropub.biology.000603. PMID: 35966394.|"Made_by: Theresa Gibney and Taylor Medwig-Kinney" | WBGene00002246(lag-2)|WBGene00003001(lin-12) | WBGene00002246(lag-2), WBGene00003001(lin-12) | WB-STRAIN:WBStrain00062586 | WormBase (WB) | WB | unknown | 2026-08-29 09:31:04 | 1 | ||||
|
Y116F11B.14(bet83) V. Resource Report Resource Website |
RRID:WB-STRAIN:WBStrain00062625 | Caenorhabditis elegans | Y116F11B.14(bet83) V. | Homozygous viable. Deletion of 1493 bp in parental strain N2. Left flanking sequence: attaatttttgaatttcctaca; Right flanking sequence: tgacgggctaatattgaatta. sgRNA #1: attacactataataatgtgt; sgRNA #2: aaacgacaaactcattatga.|"Made_by: Bettinger lab" | WB-STRAIN:WBStrain00062625 | WormBase (WB) | WB | unknown | 2026-08-29 09:31:04 | 0 | ||||||
|
algn-12(bet74) V/nT1[qls51] (IV;V). Resource Report Resource Website |
RRID:WB-STRAIN:WBStrain00062622 | Caenorhabditis elegans | algn-12(bet74) V/nT1[qls51] (IV;V). | Homozygous sterile. Balanced by nT1[qIs51]. Deletion of 3471 bp in parental strain N2. Left flanking sequence: tgatcactcacagttccctgg; Right flanking sequence: gaatggatatgatgatgtatat. sgRNA #1: atgttcgtggaacgacacca; sgRNA #2: aggataaactctctcttgaa.|"Made_by: Bettinger lab" | WBGene00022629(algn-12) | WBGene00022629(algn-12) | WB-STRAIN:WBStrain00062622 | WormBase (WB) | WB | unknown | 2026-08-29 09:31:04 | 0 | ||||
|
Y76A2B.4(bet65) III. Resource Report Resource Website |
RRID:WB-STRAIN:WBStrain00062617 | Caenorhabditis elegans | Y76A2B.4(bet65) III. | Homozygous viable. Deletion of 1579 bp in parental strain N2. Left flanking sequence: gcaaaaaaaaacataccaga; Right flanking sequence: cgtggtttcaggccattacg. sgRNA #1: cctcactgatgatcgtcatc; sgRNA #2: aaaggttcagcattcacacg.|"Made_by: Bettinger lab" | WB-STRAIN:WBStrain00062617 | WormBase (WB) | WB | unknown | 2026-08-29 09:31:04 | 0 | ||||||
|
chil-11(bet66) IV. Resource Report Resource Website |
RRID:WB-STRAIN:WBStrain00062618 | Caenorhabditis elegans | chil-11(bet66) IV. | Homozygous viable. Deletion of 2532 bp in parental strain N2. Left flanking sequence: agtcaattcggaactccatgt; Right flanking sequence: tctacggtttaaacaactcctc. sgRNA #1: aacgggatctgttcatcaca; sgRNA #2: agtgtgaaacgcaacgtcta.|"Made_by: Bettinger lab" | WBGene00016665(chil-11) | WBGene00016665(chil-11) | WB-STRAIN:WBStrain00062618 | WormBase (WB) | WB | unknown | 2026-08-29 09:31:04 | 0 | ||||
|
Y67H2A.2(bet63) IV. Resource Report Resource Website |
RRID:WB-STRAIN:WBStrain00062616 | Caenorhabditis elegans | Y67H2A.2(bet63) IV. | Homozygous viable. Deletion of 2572 bp in parental strain N2. Left flanking sequence: atctatttttttaaggccgaac; Right flanking sequence: tattggcagcaagcgttgcgaa. sgRNA #1: ccatacgttgttgtggagtt; sgRNA #2: tgtgaagcggaaaaccctat.|"Made_by: Bettinger lab" | WB-STRAIN:WBStrain00062616 | WormBase (WB) | WB | unknown | 2026-08-29 09:31:04 | 0 | ||||||
|
dmaEx617. Resource Report Resource Website |
RRID:WB-STRAIN:WBStrain00062572 | Caenorhabditis elegans | dmaEx617. | dmaEx617 [fshr-1p::fshr-1::GFP + unc-54p::mCherry]. Pick mCherry+ animals to maintain. Extrachromosomal fshr-1p::fshr-1::GFP translation reporter. Reference: Wang C, et al. Aging Cell. 2023 Jan;22(1):e13735. doi: 10.1111/acel.13735. PMID: 36415159.|"Made_by: Dengke Ma Lab" | WB-STRAIN:WBStrain00062572 | WormBase (WB) | WB | unknown | 2026-08-29 09:31:03 | 0 | ||||||
|
mir-43(sjm1) II. Resource Report Resource Website |
RRID:WB-STRAIN:WBStrain00062576 | Caenorhabditis elegans | mir-43(sjm1) II. | Homozygotes lack obvious gross phenotypes; miR-43(sjm1) accumulates in L4 larvae compared to wild-type miR-43. mir-43(sjm1) has an inversion of the miR-43 seed sequence. Reference: Stubna MW, et al. bioRxiv doi: 10.1101/2024.06.28/601170.|"Made_by: Michael Stubna" | WBGene00003271(mir-43) | WBGene00003271(mir-43) | WB-STRAIN:WBStrain00062576 | WormBase (WB) | WB | unknown | 2026-08-29 09:31:03 | 0 | ||||
|
mir-43(sjm2) II. Resource Report Resource Website |
RRID:WB-STRAIN:WBStrain00062577 | Caenorhabditis elegans | mir-43(sjm2) II. | Homozygotes lack obvious gross phenotypes. mir-43(sjm2) has positions 9-23 of miR-43 substituted for random sequence. This strain is also homozygous for a G>T point substitution at position 8 of miR-42. Reference: Stubna MW, et al. bioRxiv doi: 10.1101/2024.06.28/601170.|"Made_by: Michael Stubna" | WBGene00003271(mir-43) | WBGene00003271(mir-43) | WB-STRAIN:WBStrain00062577 | WormBase (WB) | WB | unknown | 2026-08-29 09:31:03 | 0 | ||||
|
Caenorhabditis sp. 78 wild isolate. Resource Report Resource Website |
RRID:WB-STRAIN:WBStrain00062610 | Caenorhabditis sp. 78 | Caenorhabditis sp. 78 wild isolate. | Made_by: Marie-Anne Felix and Hagus Tarno's lab|"Male-female. Maintain at 20C or warmer. Elegans group. Isofemale line isolated from rotting flowers of Stewartia pseudocamellia collected near Malino, South Sulawesi, Indonesia, on 6 May 2024. GPS -5.242944, 119.868592. Reference: Devi, et al., in preparation." | WB-STRAIN:WBStrain00062610 | WormBase (WB) | WB | unknown | 2026-08-29 09:31:04 | 0 | ||||||
|
Caenorhabditis sp. 80 wild isolate. Resource Report Resource Website |
RRID:WB-STRAIN:WBStrain00062613 | Caenorhabditis sp. 80 | Caenorhabditis sp. 80 wild isolate. | Made_by: Marie-Anne Felix and Hagus Tarno's lab|"Male-female. Maintain at 20C or warmer. Elegans group. Isofemale line isolated from rotting wild Musa pseudostems collected in the forest on the road between Bromo and Malang, East Java, Indonesia, on 11 May 2024. GPS -7.99746, 112.87387. Reference: Devi, et al., in preparation." | WB-STRAIN:WBStrain00062613 | WormBase (WB) | WB | unknown | 2026-08-29 09:31:04 | 0 | ||||||
|
nhr-31(ye123) IV. Resource Report Resource Website |
RRID:WB-STRAIN:WBStrain00062614 | Caenorhabditis elegans | nhr-31(ye123) IV. | Made_by: Youmie Kim|"Maintain at 15C. Temperature-sensitive: slow growth rate, reduced brood size. Resistant to Cry proteins. Isolated from EMS screen in N2 background. Reference: Kim YM, et al. PLoS Pathog. 2024 Oct 18;20(10):e1012611. doi: 10.1371/journal.ppat.1012611. PMID: 39423230." | WBGene00003625(nhr-31) | WBGene00003625(nhr-31) | WB-STRAIN:WBStrain00062614 | WormBase (WB) | WB | unknown | 2026-08-29 09:31:04 | 0 | ||||
|
mir-43(sjm1) II; ebax-1(tm2321) IV. Resource Report Resource Website |
RRID:WB-STRAIN:WBStrain00062579 | Caenorhabditis elegans | mir-43(sjm1) II; ebax-1(tm2321) IV. | Homozygotes lack obvious gross phenotypes, though some miRNAs are elevated due to a loss-of-function mutation in ebax-1. mir-43(sjm1) is an inversion of the seed sequence of miR-43. Generated by mating parental strain CZ9907 hermaphrodites to mir-43(sjm1) males. Reference: Stubna MW, et al. bioRxiv doi: 10.1101/2024.06.28/601170.|"Made_by: Michael Stubna" | WBGene00003271(mir-43)|WBGene00004140(ebax-1) | WBGene00003271(mir-43), WBGene00004140(ebax-1) | WB-STRAIN:WBStrain00062579 | WormBase (WB) | WB | unknown | 2026-08-29 09:31:03 | 0 | ||||
|
tdp-1(tgx58) I. Resource Report Resource Website |
RRID:WB-STRAIN:WBStrain00062607 | Caenorhabditis elegans | tdp-1(tgx58) I. | Made_by: nVivo Biosystems/ Nemametrix and Hart lab|"Null allele. CRISPR-engineered deletion of the tdp-1 locus precisely eliminates all known tdp-1 exons and introns. Reference: Lins J, et al. Generation of a C. elegans tdp-1 null allele and humanized TARDBP containing human disease-variants. MicroPubl Biol. 2023 Jun 6;2023:10.17912/micropub.biology.000693. doi: 10.17912/micropub.biology.000693. PMID: 37351305." | WBGene00006514(tdp-1) | WBGene00006514(tdp-1) | WB-STRAIN:WBStrain00062607 | WormBase (WB) | WB | unknown | 2026-08-29 09:31:04 | 0 | ||||
|
hmg-5(xn107[hmg-5::gfp]) IV. Resource Report Resource Website |
RRID:WB-STRAIN:WBStrain00062604 | Caenorhabditis elegans | hmg-5(xn107[hmg-5::gfp]) IV. | GFP-tagged HMG-5/TFAM labels mtDNA nucleoids. GFP tag causes a reduction in number of mtDNAs. Reference: Schwartz AZA, et al. eLife. 2022 Oct 6:11:e80396. doi: 10.7554/eLife.80396. PMID: 36200990.|"Made_by: Aaron Schwartz" | WBGene00001975(hmg-5) | WBGene00001975(hmg-5) | WB-STRAIN:WBStrain00062604 | WormBase (WB) | WB | unknown | 2026-08-29 09:31:04 | 0 | ||||
|
rike-1(syb1165) V/nT1[qIs51] (IV;V). Resource Report Resource Website |
RRID:WB-STRAIN:WBStrain00062608 | Caenorhabditis elegans | rike-1(syb1165) V/nT1[qIs51] (IV;V). | Heterozygotes are wild-type with pharyngeal GFP signal, and segregate WT GFP, arrested nT1[qIs51] aneuploids, and non-GFP rike-1(syb1165) homozygotes (early larval lethality). Homozygous nT1[qIs51] inviable. Pick WT GFP and check for correct segregation of progeny to maintain. Reference: Cheng X, et al. Autophagy. 2023 Jan;19(1):241-255. doi: 10.1080/15548627.2022.2071381. PMID: 35521960.|"Made_by: SunyBiotech" | WBGene00008266(rike-1) | WBGene00008266(rike-1) | WB-STRAIN:WBStrain00062608 | WormBase (WB) | WB | unknown | 2026-08-29 09:31:04 | 0 | ||||
|
Caenorhabditis sp. 77 wild isolate. Resource Report Resource Website |
RRID:WB-STRAIN:WBStrain00062609 | Caenorhabditis sp. 77 | Caenorhabditis sp. 77 wild isolate. | Made_by: Marie-Anne Felix and Hagus Tarno's lab|"Male-female. Maintain at 20C or warmer. Elegans group. Isofemale line isolated from rotting banana flowers collected in a forest near Batu, East Java, Indonesia, on 28 Apr 2024. GPS -7.803387, 112.516604. Reference: Devi, et al., in preparation." | WB-STRAIN:WBStrain00062609 | WormBase (WB) | WB | unknown | 2026-08-29 09:31:04 | 0 | ||||||
|
ahcy-1(syb748) I. Resource Report Resource Website |
RRID:WB-STRAIN:WBStrain00062562 | Caenorhabditis elegans | ahcy-1(syb748) I. | ahcy-1(syb748) is a CRISPR/Cas9-engineered C280A substitution that eliminates electrophile sensing but retains enzymatic activity.|"Made_by: SunyBiotech Co., Ltd" | WBGene00019322(ahcy-1) | WBGene00019322(ahcy-1) | WB-STRAIN:WBStrain00062562 | WormBase (WB) | WB | unknown | 2026-08-29 09:31:03 | 0 | ||||
|
col-12::mNG(ju1932) V. Resource Report Resource Website |
RRID:WB-STRAIN:WBStrain00062566 | Caenorhabditis elegans | col-12::mNG(ju1932) V. | Made_by: Jennifer Gotenstein Adams|"mNG inserted at C-terminus of endogenous col-12 locus." | WBGene00000601(col-12) | WBGene00000601(col-12) | WB-STRAIN:WBStrain00062566 | WormBase (WB) | WB | unknown | 2026-08-29 09:31:03 | 0 | ||||
|
lin-15AB(n765) X; wzIs20. Resource Report Resource Website |
RRID:WB-STRAIN:WBStrain00062603 | Caenorhabditis elegans | lin-15AB(n765) X; wzIs20. | wzIs20 [lgc-55p::GFP + lin-15(+)]. lgc-55 regulatory sequences drive expression of GFP in neurons, GLR cells and some muscles. Reference: Ringstad N, et al. Science. 2009;325(5936):96-100. doi:10.1126/science.1169243 | WBGene00003004(lin-15) | WBGene00003004(lin-15) | WB-STRAIN:WBStrain00062603 | WormBase (WB) | WB | unknown | 2026-08-29 09:31:04 | 0 |
Can't find your Organism?
We recommend that you click next to the search bar to check some helpful tips on searches and refine your search firstly. If you want to find a specific organism, it's easier to enter an RRID or a Catalog Number to search. You can refine the search results using Facets on the left side of the search results page. If you are on the table view, you can also search in a specific column by clicking the column title and enter the keywords.
If you still could not find your organism in the search results, please help us by registering it into the system — it's easy. Organisms identifiers are registered through multiple sources depending on the species:
Welcome to the NIF Resources search. From here you can search through a compilation of resources used by NIF and see how data is organized within our community.
You are currently on the Community Resources tab looking through categories and sources that NIF has compiled. You can navigate through those categories from here or change to a different tab to execute your search through. Each tab gives a different perspective on data.
If you have an account on NIF then you can log in from here to get additional features in NIF such as Collections, Saved Searches, and managing Resources.
Here is the search term that is being executed, you can type in anything you want to search for. Some tips to help searching:
If you are logged into NIF you can add data records to your collections to create custom spreadsheets across multiple sources of data.
Here are the facets that you can filter the data by.
If you have any further questions please check out our FAQs Page to ask questions and see our tutorials. Click this button to view this tutorial again.
Welcome to the Neuroscience Information Framework Project, designed to serve the biomedical research community. NIF maintains the largest searchable collection of neuroscience data, the largest catalog of biomedical resources, and the largest ontology for neuroscience on the web. We welcome all feedback and suggestions and are actively looking for resource providers to make their resources accessible through NIF. Learn about the tools available to help you share your data and discover a dynamic inventory of Web-based neuroscience resources.
