Searching the RRID Resource Information Network
Are you sure you want to leave this community? Leaving the community will revoke any permissions you have been granted in this community.
Integrated Animals is a virtual database currently indexing available animal strains and mutants from: AGSC (Ambystoma), BCBC (mice), BDSC (flies), European Xenopus Resource Center (frog), The National Xenopus Resource (frog), Xenopus Express (frog), CWRU Cystic Fibrosis Mouse Models (mice), DGGR (flies), FlyBase (flies), IMSR (mice), MGI (mice), MMRRC (mice), NSRRC (pig), RGD (rats), Sperm Stem Cell Libraries for Biological Research (rats), Tetrahymena Stock Center (Tetrahymena), WormBase (worms), XGSC (Xiphophorus), ZFIN (zebrafish), and ZIRC (zebrafish). Note, the IMSR data is linked, but users may need to re-execute the search if the top mouse is not returned properly.
Note: BCBC is no longer in service, so the links may not be functional.
http://zebrafish.org/fish/lineAll.php?t=ZIRC_Catalog_ID&sverb=exactly+matching&c=ZL9088.07
Source Database: Zebrafish Lines at ZIRC
Affected Genes: (disclaimer)
Genomic Alteration: sa12558
Availability: frozen
Notes: Allele with one point mutation
Proper citation: RRID:ZIRC_ZL9088.07 Copy
http://zebrafish.org/fish/lineAll.php?t=ZIRC_Catalog_ID&sverb=exactly+matching&c=ZL12159.01
Source Database: Zebrafish Lines at ZIRC
Affected Genes: (disclaimer)
Genomic Alteration: sa32616
Availability: frozen
Notes: Allele with one point mutation
Proper citation: RRID:ZIRC_ZL12159.01 Copy
https://www.mmrrc.org/catalog/sds.php?mmrrc_id=37643
Source Database: Mutant Mouse Resource and Research Center (MMRRC)
Genetic Background: Targeted Mutation
Affected Genes: |Mir15b|Mir16-2|
Source References: PMID: 22570807
Alternate IDs: MMRRC_37643-JAX, MMRRC_037643, MMRRC_37643
Notes: Research areas: Cancer, Research Tools; Mutation Type: Targeted Mutation ; Collection: Keck MirKO
Proper citation: RRID:MMRRC_037643-JAX Copy
https://www.mmrrc.org/catalog/sds.php?mmrrc_id=37634
Source Database: Mutant Mouse Resource and Research Center (MMRRC)
Genetic Background: Targeted Mutation
Affected Genes: Fgf8
Source References: PMID: 25889070
Alternate IDs: MMRRC_37634-UCD, MMRRC_037634, MMRRC_37634
Notes: Research areas: Developmental Biology, Neurobiology; Mutation Type: Targeted Mutation ; Collection:
Proper citation: RRID:MMRRC_037634-UCD Copy
https://www.mmrrc.org/catalog/sds.php?mmrrc_id=37683
Source Database: Mutant Mouse Resource and Research Center (MMRRC)
Genetic Background: Targeted Mutation
Affected Genes: Ccdc181
Source References: PMID: 21677750
Alternate IDs: MMRRC_37683-UCD, MMRRC_037683, MMRRC_37683
Notes: Research areas: ; Mutation Type: Targeted Mutation ; Collection: BaSH EUCOMM
Proper citation: RRID:MMRRC_037683-UCD Copy
Issue
https://www.mmrrc.org/catalog/sds.php?mmrrc_id=37631
Source Database: Mutant Mouse Resource and Research Center (MMRRC)
Genetic Background: Targeted Mutation
Affected Genes: IfngCd40lg
Source References: PMID: 23776180
Alternate IDs: MMRRC_37631-MU, MMRRC_037631, MMRRC_37631
Notes: Research areas: Immunology and Inflammation; Mutation Type: Targeted Mutation ; Collection: Mullen
Proper citation: RRID:MMRRC_037631-MU Copy
https://www.mmrrc.org/catalog/sds.php?mmrrc_id=37622
Source Database: Mutant Mouse Resource and Research Center (MMRRC)
Genetic Background: Transgenic
Affected Genes: Selenowcre
Source References: PMID: 14586460
Alternate IDs: MMRRC_37622-UCD, MMRRC_037622, MMRRC_37622
Notes: Research areas: ; Mutation Type: Transgenic ; Collection: GENSAT
Proper citation: RRID:MMRRC_037622-UCD Copy
https://www.mmrrc.org/catalog/sds.php?mmrrc_id=37788
Source Database: Mutant Mouse Resource and Research Center (MMRRC)
Genetic Background: Targeted Mutation
Affected Genes: Sun2
Source References: PMID: 21677750
Alternate IDs: MMRRC_37788-UCD, MMRRC_037788, MMRRC_37788
Notes: Research areas: ; Mutation Type: Targeted Mutation ; Collection: BaSH EUCOMM
Proper citation: RRID:MMRRC_037788-UCD Copy
https://www.mmrrc.org/catalog/sds.php?mmrrc_id=37721
Source Database: Mutant Mouse Resource and Research Center (MMRRC)
Genetic Background: Targeted Mutation
Affected Genes: Gdf11
Source References: PMID: 21677750
Alternate IDs: MMRRC_37721-UCD, MMRRC_037721, MMRRC_37721
Notes: Research areas: ; Mutation Type: Targeted Mutation ; Collection: BaSH EUCOMM
Proper citation: RRID:MMRRC_037721-UCD Copy
https://www.mmrrc.org/catalog/sds.php?mmrrc_id=37785
Source Database: Mutant Mouse Resource and Research Center (MMRRC)
Genetic Background: Targeted Mutation
Affected Genes: Smdt1
Source References: PMID: 21677750
Alternate IDs: MMRRC_37785-UCD, MMRRC_037785, MMRRC_37785
Notes: Research areas: ; Mutation Type: Targeted Mutation ; Collection: BaSH EUCOMM
Proper citation: RRID:MMRRC_037785-UCD Copy
https://www.mmrrc.org/catalog/sds.php?mmrrc_id=37780
Source Database: Mutant Mouse Resource and Research Center (MMRRC)
Genetic Background: Targeted Mutation
Affected Genes: Skic2
Source References: PMID: 21677750
Alternate IDs: MMRRC_37780-UCD, MMRRC_037780, MMRRC_3778
Notes: Research areas: ; Mutation Type: Targeted Mutation ; Collection: BaSH EUCOMM
Proper citation: RRID:MMRRC_037780-UCD Copy
https://www.mmrrc.org/catalog/sds.php?mmrrc_id=37822
Source Database: Mutant Mouse Resource and Research Center (MMRRC)
Genetic Background: Targeted Mutation
Affected Genes: Dapk1
Source References: PMID: 21677750
Alternate IDs: MMRRC_37822-UCD, MMRRC_037822, MMRRC_37822
Notes: Research areas: ; Mutation Type: Targeted Mutation ; Collection: BaSH EUCOMM
Proper citation: RRID:MMRRC_037822-UCD Copy
https://www.mmrrc.org/catalog/sds.php?mmrrc_id=38349
Source Database: Mutant Mouse Resource and Research Center (MMRRC)
Genetic Background: chemically induced mutation
Affected Genes: Atp6v1h|Cracdl|Unc80|Gli2|Cd55|Mybph|BC034090|Mettl13|Mcm10|Ly75|Lin7c|Or4k37|Helz2|Gm12887|Fzd1|Sema3a|Ccdc146|Slit2|Slc4a4|Ephx4|Fbxo21|Plxna1|Frmd4b|A2ml1|Grin2b|Itpr2|Ccdc61|Or51ah3|Or52e18|Dennd5a|Spn|Cfap96|Ucp1|Cacna1a|Dop1a|Slc22a5|Nf1|Slfn10|Plcd3|Vsnl1|Rps6ka5|Bcl11b|Qng1|Zfp457|Zdhhc11|Cdk7|Rarb|Nefm|Scube1|Grin2a|Tbccd1|Runx1|Itpr3|Phf8l|Or2j3|Morn2|Slc25a45|Cox8a|Slc15a3
Alternate IDs: MMRRC_38349-MU, MMRRC_038349, MMRRC_38349
Notes: Research areas: ; Mutation Type: chemically induced mutation ; Collection: Beutler Mutagenetix
Proper citation: RRID:MMRRC_038349-MU Copy
http://www.wormbase.org/db/get?name=WBStrain00036329
Source Database: WormBase (WB)
Affected Genes: WBGene00003056(lon-2)|WBGene00003752(nlp-14)
Genomic Alteration: WBGene00003056(lon-2), WBGene00003752(nlp-14)
Availability: available
Synonyms: +/szT1 [lon-2(e678)] I; nlp-14(ok1517)/szT1 X.
Alternate IDs: WB-STRAIN:VC1108, CGC_VC1108
Notes: D1009.4. Apparent homozygous lethal deletion chromosome balanced by lon-2-marked translocation. Heterozygotes are WT, and segregate WT, Lon-2 males, arrested szT1 aneuploids, and ok1517 homozygotes (arrest stage/phenotype undetermined). Pick WT and check for correct segregation of progeny to maintain.|"Mutagen:UV/TMP"|"This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use."
Proper citation: RRID:WB-STRAIN:WBStrain00036329 Copy
http://www.wormbase.org/db/get?name=WBStrain00036328
Source Database: WormBase (WB)
Affected Genes: WBGene00022235(sqd-1)
Genomic Alteration: WBGene00022235(sqd-1)
Availability: available
Synonyms: sqd-1(ok1582) IV/nT1 [qIs51] (IV;V).
Alternate IDs: WB-STRAIN:VC1106, CGC_VC1106
Notes: Mutagen:UV/TMP|"This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use."|"Y73B6BL.6. Homozygous lethal deletion chromosome balanced by GFP-marked translocation. Heterozygotes are WT with pharyngeal GFP signal, and segregate WT GFP, arrested nT1[qIs51] aneuploids, and non-GFP ok1582 homozygotes (sterile adult). Homozygous nT1[qIs51] inviable. Pick WT GFP and check for correct segregation of progeny to maintain."
Proper citation: RRID:WB-STRAIN:WBStrain00036328 Copy
http://www.wormbase.org/db/get?name=WBStrain00036323
Source Database: WormBase (WB)
Affected Genes: WBGene00002008(hsp-4)
Genomic Alteration: WBGene00002008(hsp-4)
Availability: available
Source References: PMID:34407398, PMID:36924492
Synonyms: hsp-4(gk514) II.
Alternate IDs: WB-STRAIN:VC1099, CGC_VC1099
Notes: F43E2.8. Superficially wild type.|"Mutagen:UV/TMP"|"Supplementary_genotype hsp-4(gk514) II"|"This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use."|"WBStrain provided so WBPaper00061805 paper added based on AFP_Strain data."
Proper citation: RRID:WB-STRAIN:WBStrain00036323 Copy
http://www.wormbase.org/db/get?name=WBStrain00036497
Source Database: WormBase (WB)
Affected Genes: WBGene00004884(smg-6)
Genomic Alteration: WBGene00004884(smg-6)
Availability: available
Synonyms: smg-6(ok1794) III.
Alternate IDs: WB-STRAIN:VC1305, CGC_VC1305
Notes: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use.|"Y54F10AL.2. Superficially wild type. External left primer: TAGCTAGCCCATGTGCCTTT. External right primer: TTTTGCGATGTGAATCGTGT. Internal left primer: TTTTAGCCACACCATCCACA. Internal right primer: CCAAAAACATGGGAAAATCG. Internal WT amplicon: 3113 bp. Deletion size: 920 bp. Deletion left flank: CAATTAAAAATTTTTTTTCTTGATTTTCTA. Deletion right flank: AAAATTGTGTCTAGGGGTGAAAAATTGCGA."
Proper citation: RRID:WB-STRAIN:WBStrain00036497 Copy
http://www.wormbase.org/db/get?name=WBStrain00036424
Source Database: WormBase (WB)
Affected Genes: WBGene00002101(ins-18)
Genomic Alteration: WBGene00002101(ins-18)
Availability: available
Synonyms: ins-18(ok1672) I.
Alternate IDs: WB-STRAIN:VC1218, CGC_VC1218
Notes: T28B8.2. Superficially wild type. External left primer: TTCAGATTGCTCGAAAGGCT. External right primer: GCCATTGTATCCATCCCATC. Internal left primer: CGTCGCCACTATTCCAAAAT. Internal right primer: CGTATTTTGTGGGCGGTACT. Internal WT amplicon: 2143 bp. Deletion size: 940 bp. Deletion left flank: AAGCTGGTTTGTTTTCATGTTTGTAATACA. Deletion right flank: TTTGGCAATTGGCAATTATTTAATTCTTTT.|"This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use."
Proper citation: RRID:WB-STRAIN:WBStrain00036424 Copy
http://www.wormbase.org/db/get?name=WBStrain00036431
Source Database: WormBase (WB)
Affected Genes: WBGene00002222(klp-11)
Genomic Alteration: WBGene00002222(klp-11)
Availability: available
Source References: PMID:37463209, PMID:38302462
Synonyms: klp-11(tm324) IV.
Alternate IDs: WB-STRAIN:VC1228, CGC_VC1228
Notes: 331 bp deletion. T608 Stop. Flanking sequences: aaaatgagaaaaggaacaactgaattggac taatttttaaacacaaaacttactattgtt.|"Mutagen:UV/TMP"|"This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use."
Proper citation: RRID:WB-STRAIN:WBStrain00036431 Copy
http://www.wormbase.org/db/get?name=WBStrain00036435
Source Database: WormBase (WB)
Affected Genes: WBGene00003839(ocr-2)
Genomic Alteration: WBGene00003839(ocr-2)
Availability: available
Source References: PMID:36652499
Synonyms: ocr-2(ok1711) IV.
Alternate IDs: WB-STRAIN:VC1233, CGC_VC1233
Notes: T09A12.3. Superficially wild type. External left primer: TAGCATTTGTAAAACCCGGC. External right primer: AAAAACCCCCAATTTTCCTG. Internal left primer: CGAAAGCTTCAATGGGTGAT. Internal right primer: GGCTCCGAAAGCTTACCTCT. Internal WT amplicon: 2957 bp. Deletion size: 1512 bp.|"This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use."
Proper citation: RRID:WB-STRAIN:WBStrain00036435 Copy
Can't find your Organism?
We recommend that you click next to the search bar to check some helpful tips on searches and refine your search firstly. If you want to find a specific organism, it's easier to enter an RRID or a Catalog Number to search. You can refine the search results using Facets on the left side of the search results page. If you are on the table view, you can also search in a specific column by clicking the column title and enter the keywords.
If you still could not find your organism in the search results, please help us by registering it into the system — it's easy. Organisms identifiers are registered through multiple sources depending on the species:
Welcome to the NIF Resources search. From here you can search through a compilation of resources used by NIF and see how data is organized within our community.
You are currently on the Community Resources tab looking through categories and sources that NIF has compiled. You can navigate through those categories from here or change to a different tab to execute your search through. Each tab gives a different perspective on data.
If you have an account on NIF then you can log in from here to get additional features in NIF such as Collections, Saved Searches, and managing Resources.
Here is the search term that is being executed, you can type in anything you want to search for. Some tips to help searching:
You can save any searches you perform for quick access to later from here.
We recognized your search term and included synonyms and inferred terms along side your term to help get the data you are looking for.
If you are logged into NIF you can add data records to your collections to create custom spreadsheets across multiple sources of data.
Here are the sources that were queried against in your search that you can investigate further.
Here are the categories present within NIF that you can filter your data on
Here are the subcategories present within this category that you can filter your data on
If you have any further questions please check out our FAQs Page to ask questions and see our tutorials. Click this button to view this tutorial again.
Welcome to the Neuroscience Information Framework Project, designed to serve the biomedical research community. NIF maintains the largest searchable collection of neuroscience data, the largest catalog of biomedical resources, and the largest ontology for neuroscience on the web. We welcome all feedback and suggestions and are actively looking for resource providers to make their resources accessible through NIF. Learn about the tools available to help you share your data and discover a dynamic inventory of Web-based neuroscience resources.
