Searching the RRID Resource Information Network
Are you sure you want to leave this community? Leaving the community will revoke any permissions you have been granted in this community.
Integrated Animals is a virtual database currently indexing available animal strains and mutants from: AGSC (Ambystoma), BCBC (mice), BDSC (flies), European Xenopus Resource Center (frog), The National Xenopus Resource (frog), Xenopus Express (frog), CWRU Cystic Fibrosis Mouse Models (mice), DGGR (flies), FlyBase (flies), IMSR (mice), MGI (mice), MMRRC (mice), NSRRC (pig), RGD (rats), Sperm Stem Cell Libraries for Biological Research (rats), Tetrahymena Stock Center (Tetrahymena), WormBase (worms), XGSC (Xiphophorus), ZFIN (zebrafish), and ZIRC (zebrafish). Note, the IMSR data is linked, but users may need to re-execute the search if the top mouse is not returned properly.
Note: BCBC is no longer in service, so the links may not be functional.
| Organism Name | Proper Citation | Species | Synonyms |
Notes |
Phenotype | Affected Gene | ||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
|
RB2544 Resource Report Resource Website 1+ mentions |
RRID:WB-STRAIN:WBStrain00033219 | Caenorhabditis elegans | ins-4(ok3534) | Made_by: OMRF Knockout Group|"This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use."|"ZK75.1 Homozygous. Outer Left Sequence: ccggtaccgacttggaacta. Outer Right Sequence: agaaagctgggtcgtgagac. Inner Left Sequence: caaaagcgttcactctagaaaat. Inner Right Sequence: aaaaagacaaccgtccctcc. Inner Primer PCR Length: 1111. Estimated Deletion Size: about 400 bp." | WBGene00002087(ins-4) | WBGene00002087(ins-4) | WB-STRAIN:WBStrain00033219 | WormBase (WB) | WB | available | PMID:34634043 | WB-STRAIN:RB2544, CGC_RB2544 | 2026-08-29 09:21:55 | 1 | ||
|
RB2535 Resource Report Resource Website |
RRID:WB-STRAIN:WBStrain00033210 | Caenorhabditis elegans | K10H10.2(ok3516) II. | K10H10.2 Homozygous. Outer Left Sequence: ttactttcgaggttggaggc. Outer Right Sequence: tcgtttactcatctcgcacg. Inner Left Sequence: cccatgaaagccctacattt. Inner Right Sequence: cgctttttgttgaaaagttcg. Inner Primer PCR Length: 1235. Estimated Deletion Size: about 600 bp.|"Made_by: OMRF Knockout Group"|"This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use." | WBGene00010759(cysl-2) | WBGene00010759(cysl-2) | WB-STRAIN:WBStrain00033210 | WormBase (WB) | WB | available | WB-STRAIN:RB2535, CGC_RB2535 | 2026-08-29 09:21:55 | 0 | |||
|
RB2625 Resource Report Resource Website |
RRID:WB-STRAIN:WBStrain00033299 | Caenorhabditis elegans | F40F12.7(ok3684) III. | F40F12.7 Homozygous. Outer Left Sequence: aggcaaaccataagcctgaa. Outer Right Sequence: catctttgattttcccgcat. Inner Left Sequence: tggtttttgcattttcaacc. Inner Right Sequence: aaaacactggatccgcattg. Inner Primer PCR Length: 1232. Estimated Deletion Size: about 1000 bp.|"Made_by: OMRF Knockout Group"|"This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use." | WBGene00009595(cbp-3) | WBGene00009595(cbp-3) | WB-STRAIN:WBStrain00033299 | WormBase (WB) | WB | available | WB-STRAIN:RB2625, CGC_RB2625 | 2026-08-29 09:21:57 | 0 | |||
|
RB2537 Resource Report Resource Website |
RRID:WB-STRAIN:WBStrain00033212 | Caenorhabditis elegans | T02C12.4(ok3518) III. | Made_by: OMRF Knockout Group|"T02C12.4 Homozygous. Outer Left Sequence: gcgaaaggagcattcttcag. Outer Right Sequence: gaggaggaaaacgtggtgaa. Inner Left Sequence: aatttcttgatttcagccagc. Inner Right Sequence: caatggatcgaatggaacaa. Inner Primer PCR Length: 1189. Estimated Deletion Size: about 600 bp."|"This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use." | WBGene00011369(T02C12.4) | WBGene00011369(T02C12.4) | WB-STRAIN:WBStrain00033212 | WormBase (WB) | WB | available | WB-STRAIN:RB2537, CGC_RB2537 | 2026-08-29 09:21:55 | 0 | |||
|
RB2538 Resource Report Resource Website |
RRID:WB-STRAIN:WBStrain00033213 | Caenorhabditis elegans | Y44E3A.3(ok3519) I. | Made_by: OMRF Knockout Group|"This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use."|"Y44E3A.3 Homozygous. Outer Left Sequence: tatcgctgccacaattcaaa. Outer Right Sequence: acgcgaacgctaaaattctg. Inner Left Sequence: ccgtaaatcgacacaagtgc. Inner Right Sequence: gcgtattgagcaaaagacgaa. Inner Primer PCR Length: 1206. Estimated Deletion Size: about 300 bp." | WBGene00021548(trx-4) | WBGene00021548(trx-4) | WB-STRAIN:WBStrain00033213 | WormBase (WB) | WB | available | WB-STRAIN:RB2538, CGC_RB2538 | 2026-08-29 09:21:55 | 0 | |||
|
RB5000 Resource Report Resource Website |
RRID:WB-STRAIN:WBStrain00033304 | Caenorhabditis elegans | dpy-1(ok5083) III. | Made_by: OMRF KO Group|"This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use."|"Whole-genome sequenced strain. Dpy. It has not been confirmed that this phenotype is the result of ok5083. This strain was isolated after EMS mutagenesis of VC2010 and subjected to whole-genome sequencing (Flibotte et al., Genetics 185: 431 - 441 (2010). In addition to ok5083, it is homozygous for 196 other mutations determined from sequence data. All mutations are annotated in WormBase." | WBGene00001063(dpy-1) | WBGene00001063(dpy-1) | WB-STRAIN:WBStrain00033304 | WormBase (WB) | WB | available | WB-STRAIN:RB5000, CGC_RB5000 | 2026-08-29 09:21:57 | 0 | |||
|
RB5001 Resource Report Resource Website |
RRID:WB-STRAIN:WBStrain00033305 | Caenorhabditis elegans | Whole-genome sequenced strain. | Made_by: OMRF KO Group|"This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use."|"Whole-genome sequenced strain. Dpy. The mutation responsible for this phenotype has not been identified. This strain was isolated after EMS mutagenesis of VC2010 and subjected to whole-genome sequencing (Flibotte et al., Genetics 185: 431 - 441 (2010). It is homozygous for 289 mutations determined from sequence data, all of which are annotated in WormBase." | WB-STRAIN:WBStrain00033305 | WormBase (WB) | WB | available | WB-STRAIN:RB5001, CGC_RB5001 | 2026-08-29 09:21:57 | 0 | |||||
|
RBW2642 Resource Report Resource Website |
RRID:WB-STRAIN:WBStrain00033307 | Caenorhabditis elegans | hutSi2642 II; unc-119(ed3) III. | hutSi2642 [hsp-90p::mCherry::unc-54 3'UTR + Cbr-unc-119 (+)] II. Expresses a single copy of mCherry from hsp-90 promoter; construct utilizes the unc-54 terminator and 3'UTR. Can be used as a standard for multicolor imaging and quantitative microscopy. hsp-90 previously known as daf-21. Reference: Sands B, et al. 2018. Translational Medicine of Aging Volume 2, January 2018, Pages 110. | WBGene00006843(unc-119) | WBGene00006843(unc-119) | WB-STRAIN:WBStrain00033307 | WormBase (WB) | WB | available | WB-STRAIN:RBW2642, CGC_RBW2642 | 2026-08-29 09:21:57 | 0 | |||
|
RBW2661 Resource Report Resource Website |
RRID:WB-STRAIN:WBStrain00033308 | Caenorhabditis elegans | hutSi2661 II; unc-119(ed3) III | hutSi2661 [hsp-90p::eGFPT::unc-54 3'UTR + Cbr-unc-119 (+)] II. Expresses a single copy of mEGFP from hsp-90 promoter; construct utilizes the unc-54 terminator and 3'UTR. Can be used as a standard for multicolor imaging and quantitative microscopy. hsp-90 previously known as daf-21. Reference: Sands B, et al. 2018. Translational Medicine of Aging Volume 2, January 2018, Pages 110. | WBGene00006843(unc-119) | WBGene00006843(unc-119) | WB-STRAIN:WBStrain00033308 | WormBase (WB) | WB | available | WB-STRAIN:RBW2661, CGC_RBW2661 | 2026-08-29 09:21:57 | 0 | |||
|
RC301 Resource Report Resource Website 1+ mentions |
RRID:WB-STRAIN:WBStrain00033309 | Caenorhabditis elegans | Caenorhabditis elegans wild isolate. | Reference WBG 9(3) 29 and 10(2) 140-141. npr-1 pka bor-1. Caenorhabditis elegans wild isolate (Tc1 pattern HCF).|"Reference WBPaper00058832 added based on published strain data identified by Textpresso literature search." | WB-STRAIN:WBStrain00033309 | WormBase (WB) | WB | available | PMID:9136008 PMID:9741632 PMID:18801967 PMID:18993077 PMID:31704915 PMID:33820969 PMID:38564369 |
WB-STRAIN:RC301, CGC_RC301 | 2026-08-29 09:21:57 | 1 | ||||
|
RM1677 Resource Report Resource Website |
RRID:WB-STRAIN:WBStrain00033384 | Caenorhabditis elegans | unc-41(md152) V. | unc-41(md152) is a 1 bp deletion after amino acid 872 in exon 8 producing GLHKS*. wt sequence: GCTAACTCTTGTGCAGCCCG. md152 sequence: GCTAACTCTTGTGCAGCCCA. | WBGene00006777(unc-41) | WBGene00006777(unc-41) | WB-STRAIN:WBStrain00033384 | WormBase (WB) | WB | unknown | WB-STRAIN:RM1677 | 2026-08-29 09:21:58 | 0 | |||
|
RM1702 Resource Report Resource Website |
RRID:WB-STRAIN:WBStrain00033385 | Caenorhabditis elegans | ric-8(md303) IV. | Made_by: J. Rand/K. Miller|"Ric, Egl, severely locomotion defective, reduced body flexion/straight posture, pharyngeal pumping and growth rate slightly lower than WT. Does not reproduce at 25C. Brood size about 1/10 of WT at 20C, and about 1/3 of WT at 14C. 29% of eggs do not hatch. Early embryogenesis defects include misalignment of mitotic spindles and delayed migration of nuclei. Grows best at 14C but you can still work with it and do crosses at 20C." | WBGene00004367(ric-8) | WBGene00004367(ric-8) | WB-STRAIN:WBStrain00033385 | WormBase (WB) | WB | available | PMID:8901627 | WB-STRAIN:RM1702, CGC_RM1702 | 2026-08-29 09:21:58 | 0 | ||
|
RM1845 Resource Report Resource Website |
RRID:WB-STRAIN:WBStrain00033387 | Caenorhabditis elegans | cat-1(e1111) X. | Catecholamine abnormal. See Duerr JS, et al. J Neurosci. 1999 Jan 1;19(1):72-84. for description of phenotypes. | WBGene00000295(cat-1) | WBGene00000295(cat-1) | WB-STRAIN:WBStrain00033387 | WormBase (WB) | WB | available | WB-STRAIN:RM1845, CGC_RM1845 | 2026-08-29 09:21:58 | 0 | |||
|
RM2037 Resource Report Resource Website |
RRID:WB-STRAIN:WBStrain00033389 | Caenorhabditis elegans | unc-17(e245) cho-1(tm373) IV. | Loosely-linked (~12 cM apart) cholinergic mutants. Aldicarb-resistant, small, Unc-coily, slow-growing, slow pharyngeal pumping. cho-1(tm373) is a null deletion allele of the gene encoding the plasma membrane choline transporter, and unc-17(e245) is a strong missense allele of the synaptic vesicle acetylcholine transporter. References: Mullen GP, et al. Genetics. 2007 Sep;177(1):195-204.|"Made_by: Mai Vu" | WBGene00000501(cho-1)|WBGene00006756(unc-17) | WBGene00000501(cho-1), WBGene00006756(unc-17) | WB-STRAIN:WBStrain00033389 | WormBase (WB) | WB | available | WB-STRAIN:RM2037, CGC_RM2037 | 2026-08-29 09:21:58 | 0 | |||
|
RM2431 Resource Report Resource Website |
RRID:WB-STRAIN:WBStrain00033392 | Caenorhabditis elegans | unc-13(md2415)/hT1 I; +/hT1 V. | Heterozygotes are WT and segregate WT, hT1 homozygotes (mid-larval lethals), md2415 homozygotes (generally L1 lethals which are almost completely paralyzed and have a coily posture with some head movement), and dead eggs. md2415 has a 2.7 kb deletion in the unc-13R region.|"Made_by: Moulder/Eustance-Koh"|"Mutagen: Psoralen"|"Supplementary_genotype unc-13(md2415)/hT1 I; +/hT1 V." | WBGene00006752(unc-13) | WBGene00006752(unc-13) | WB-STRAIN:WBStrain00033392 | WormBase (WB) | WB | available | PMID:36617680 | WB-STRAIN:RM2431, CGC_RM2431 | 2026-08-29 09:21:58 | 0 | ||
|
RE666 Resource Report Resource Website 1+ mentions |
RRID:WB-STRAIN:WBStrain00033316 | Caenorhabditis elegans | ire-1(v33) II. | Made_by: X. Shen|"Slow growth. Abnormal tail."|"Supplementary_genotype ire-1(v33) II" | WBGene00002147(ire-1) | WBGene00002147(ire-1) | WB-STRAIN:WBStrain00033316 | WormBase (WB) | WB | available | PMID:33542359 PMID:36924492 PMID:39436952 |
WB-STRAIN:RE666, CGC_RE666 | 2026-08-29 09:21:57 | 2 | ||
|
RFK607 Resource Report Resource Website |
RRID:WB-STRAIN:WBStrain00033318 | Caenorhabditis elegans | gtsf-1(xf43) IV. | Eri, reduced brood size at 20C and sterility at 25C. Slightly Him. Reference: Almeida et al, 2018. The EMBO Journal, e99325. | WBGene00020286(gtsf-1) | WBGene00020286(gtsf-1) | WB-STRAIN:WBStrain00033318 | WormBase (WB) | WB | available | WB-STRAIN:RFK607, CGC_RFK607 | 2026-08-29 09:21:57 | 0 | |||
|
RFK608 Resource Report Resource Website |
RRID:WB-STRAIN:WBStrain00033319 | Caenorhabditis elegans | gtsf-1(xf44) IV. | Eri, reduced brood size at 20C and sterility at 25C. Slightly Him. Reference: Almeida et al, 2018. The EMBO Journal, e99325. | WBGene00020286(gtsf-1) | WBGene00020286(gtsf-1) | WB-STRAIN:WBStrain00033319 | WormBase (WB) | WB | available | WB-STRAIN:RFK608, CGC_RFK608 | 2026-08-29 09:21:57 | 0 | |||
|
RM2710 Resource Report Resource Website 1+ mentions |
RRID:WB-STRAIN:WBStrain00033395 | Caenorhabditis elegans | snf-11(ok156) V. | Made_by: OMRF Knockout Group|"Mutagen:UV/TMP"|"No obvious phenotype."|"Superficially wild-type growth and behavior. unc-25-dependent aldicarb resistance. unc-25-dependent phenotypes are not rescued by exogenous GABA. Molecular details: 1491-bp deletion, removes exon 3, exon 4, and most of exon 5. Flanking sequences: AAAACTTCCACCAAGCACTT/ /AATTATATAACTATGTCACA Reference: Mullen GP, et al. Mol Biol Cell. 2006 Jul;17(7):3021-30." | WBGene00004910(snf-11) | WBGene00004910(snf-11) | WB-STRAIN:WBStrain00033395 | WormBase (WB) | WB | available | PMID:31415799 | WB-STRAIN:RM2710, CGC_RM2710 | 2026-08-29 09:21:59 | 1 | ||
|
RM2711 Resource Report Resource Website |
RRID:WB-STRAIN:WBStrain00033396 | Caenorhabditis elegans | unc-25(e156) III; snf-11(ok156) V. | Superficially similar to unc-25 mutants (Shrinker, Exp, etc.), except that unc-25-dependent behaviors are not rescued by exogenous GABA. Reference: Mullen GP, et al. Mol Biol Cell. 2006 Jul;17(7):3021-30. | WBGene00004910(snf-11)|WBGene00006762(unc-25) | WBGene00004910(snf-11), WBGene00006762(unc-25) | WB-STRAIN:WBStrain00033396 | WormBase (WB) | WB | available | WB-STRAIN:RM2711, CGC_RM2711 | 2026-08-29 09:21:59 | 0 |
Can't find your Organism?
We recommend that you click next to the search bar to check some helpful tips on searches and refine your search firstly. If you want to find a specific organism, it's easier to enter an RRID or a Catalog Number to search. You can refine the search results using Facets on the left side of the search results page. If you are on the table view, you can also search in a specific column by clicking the column title and enter the keywords.
If you still could not find your organism in the search results, please help us by registering it into the system — it's easy. Organisms identifiers are registered through multiple sources depending on the species:
Welcome to the NIF Resources search. From here you can search through a compilation of resources used by NIF and see how data is organized within our community.
You are currently on the Community Resources tab looking through categories and sources that NIF has compiled. You can navigate through those categories from here or change to a different tab to execute your search through. Each tab gives a different perspective on data.
If you have an account on NIF then you can log in from here to get additional features in NIF such as Collections, Saved Searches, and managing Resources.
Here is the search term that is being executed, you can type in anything you want to search for. Some tips to help searching:
If you are logged into NIF you can add data records to your collections to create custom spreadsheets across multiple sources of data.
Here are the facets that you can filter the data by.
If you have any further questions please check out our FAQs Page to ask questions and see our tutorials. Click this button to view this tutorial again.
Welcome to the Neuroscience Information Framework Project, designed to serve the biomedical research community. NIF maintains the largest searchable collection of neuroscience data, the largest catalog of biomedical resources, and the largest ontology for neuroscience on the web. We welcome all feedback and suggestions and are actively looking for resource providers to make their resources accessible through NIF. Learn about the tools available to help you share your data and discover a dynamic inventory of Web-based neuroscience resources.
