Searching the RRID Resource Information Network

Our searching services are busy right now. Please try again later

  • Register
X
Forgot Password

If you have forgotten your password you can enter your email here and get a temporary password sent to your email.

X

Leaving Community

Are you sure you want to leave this community? Leaving the community will revoke any permissions you have been granted in this community.

No
Yes

Integrated Animals is a virtual database currently indexing available animal strains and mutants from: AGSC (Ambystoma), BCBC (mice), BDSC (flies), European Xenopus Resource Center (frog), The National Xenopus Resource (frog), Xenopus Express (frog), CWRU Cystic Fibrosis Mouse Models (mice), DGGR (flies), FlyBase (flies), IMSR (mice), MGI (mice), MMRRC (mice), NSRRC (pig), RGD (rats), Sperm Stem Cell Libraries for Biological Research (rats), Tetrahymena Stock Center (Tetrahymena), WormBase (worms), XGSC (Xiphophorus), ZFIN (zebrafish), and ZIRC (zebrafish). Note, the IMSR data is linked, but users may need to re-execute the search if the top mouse is not returned properly.
Note: BCBC is no longer in service, so the links may not be functional.

Suggested Search Criteria

Enter extra filters to help narrow your search

Search

Type in a keyword to search

On page 125 showing 2481 ~ 2500 out of 64,152 results
Snippet view Table view Download Top 1000 Results
Click the to add this resource to a Collection

http://www.wormbase.org/db/get?name=WBStrain00051681

Source Database: WormBase (WB)
Affected Genes: WBGene00001073(dpy-11)|WBGene00006761(unc-24)|WBGene00008140(xpf-1)|WBGene00008346(C56A3.8)
Genomic Alteration: WBGene00001073(dpy-11), WBGene00006761(unc-24), WBGene00008140(xpf-1), WBGene00008346(C56A3.8)
Availability: unknown
Source References: EMPTY
Synonyms: xpf-1(e1487) II; unc-24(e138)/nt1[let (m435)] IV; dpy-11(e224) C56A3.8(t2029)/nt1[let (m435)] V.
Notes: him-9 is other name for xpf-1|"Made_by: Vancouver KO Group"|"Maternal effect lethal mutation linked to dpy-11(e224) and pseudolinked to unc-24(e138), and balanced by recessive lethal translocation. Heterozygotes are WT and segregate WT, arrested nT1 aneuploids, arrested nT1 homozygotes, and viable DpyUnc t2029 homozygotes that produce unfertilized oocytes. GE2734 is also homozygous for him-9(e1487) so that male progeny are segregated. Pick WT and check for correct segregation of progeny to maintain. Please reference Li-Leger et al., G3 11(12) 2021 in any work resulting from use of this mutation."|"Maternal effect lethal mutation linked to dpy-11(e224) and pseudolinked to unc-24(e138), and balanced by recessive lethal translocation. Heterozygotes are WT and segregate WT, arrested nT1 aneuploids, arrested nT1 homozygotes, and viable DpyUnc t2029 homozygotes that produce unfertilized oocytes. GE2734 is also homozygous for xpf-1(e1487) so that male progeny are segregated. Pick WT and check for correct segregation of progeny to maintain. Please reference Li-Leger et al., G3 11(12) 2021 in any work resulting from use of this mutation. xpf-1 previously known as him-9."

Proper citation: RRID:WB-STRAIN:WBStrain00051681 Copy   


http://www.wormbase.org/db/get?name=WBStrain00051686

Source Database: WormBase (WB)
Affected Genes: WBGene00001946(his-72)|WBGene00006843(unc-119)
Genomic Alteration: WBGene00001946(his-72), WBGene00006843(unc-119)
Availability: unknown
Source References: EMPTY
Synonyms: muIs252 II; unc-119(ed3) his-72(utx21[his-72::wrmScarlet11::3xMyc]) III.
Notes: Made_by: Ella DeMott (Glow Worms '20)|"muIs252 [eft-3p::wrmScarlet1-10::unc-54 3'UTR + Cbr-unc-119(+)] II. C-terminal tag of HIS-72 via CRISPR/Cas9 knock-in of wrmScarlet11 into endogenous his-72 locus. Genetic background: strain CF4582. Insertion verified by PCR and fluorescence. Left flank: 5' CTCGCCAGACGCATTCGCGGAGAACGTGCT 3' (one silent mutation); Right flank: 5' TAAgctccatcaccaattctcgaagcactt 3'; sgRNA: GAGCTTAAGCACGTTCTCCG; Cas9/sgRNA plasmid: pGLOW87; wrmScarlet11^SEC^3xMyc plasmid: pGLOW88; SEC insertion allele strain: GLW26"

Proper citation: RRID:WB-STRAIN:WBStrain00051686 Copy   


  • RRID:WB-STRAIN:WBStrain00051724

http://www.wormbase.org/db/get?name=WBStrain00051724

Source Database: WormBase (WB)
Affected Genes: WBGene00000528(clh-1)
Genomic Alteration: WBGene00000528(clh-1)
Availability: unknown
Source References: EMPTY
Synonyms: clh-1(pe572) II.
Notes: Made_by: Park C.|"pe572 mutants exhibit defects in salt chemotaxis after low salt concentration with food conditioning. Reference: Park C, et al. Elife. 2021 Jan 25;10:e55701. doi: 10.7554/eLife.55701. PMID: 33492228"

Proper citation: RRID:WB-STRAIN:WBStrain00051724 Copy   


http://www.wormbase.org/db/get?name=WBStrain00051689

Source Database: WormBase (WB)
Affected Genes: WBGene00020481(gldi-2)
Genomic Alteration: WBGene00020481(gldi-2)
Availability: unknown
Source References: EMPTY
Synonyms: gldi-2(utx27[mNG::3xFlag::T13C2.6]) II.
Notes: Made_by: Staci Guillen (Glow Worms '21)|"T13C2.6. N-terminal tag of T13C2.6 via CRISPR/Cas9 knock-in of mNeonGreen at gldi-2 locus. Insertion verified by PCR and fluorescence. Left flank: 5' aaatattaattgataatcagaggagtaaaa 3'; Right flank: 5' ATGAGGACATGTCTCACCCTCACGGGTTTC 3'; sgRNA: taatcagaggagtaaaaATG; Cas9/sgRNA plasmid: pGLOW45; mNG^SEC^3xFlag plasmid: pGLOW54; SEC insertion allele strain: GLW34."

Proper citation: RRID:WB-STRAIN:WBStrain00051689 Copy   


http://www.wormbase.org/db/get?name=WBStrain00051688

Source Database: WormBase (WB)
Availability: unknown
Source References: EMPTY
Synonyms: T28D6.6(utx25[T28D6.6::mNG::3xFlag]) III.
Notes: Made_by: Skye Waterland (Glow Worms '20)|"Superficially wild type. C-terminal tag of T28D6.6 via CRISPR/Cas9 knock-in of mNeonGreen at T28D6.6 locus. Insertion verified by PCR and fluorescence. Left flank: 5' gtcgcaaataatggttttttttccagAGTC 3'; Right flank: 5' TAAgctgaaattcccgtgcttctcgtcttc 3'; sgRNA: gggaatttcagcTTAGACTc; Cas9/sgRNA plasmid: pGLOW2; mNG^SEC^3xFlag plasmid: pGLOW42; SEC insertion allele strain: GLW32. Reference: Huang et al. 2021. Improved CRISPR/Cas9 knock-in efficiency via the self-excising cassette (SEC) selection method in C. elegans. 2021 Sep 16;2021:10.17912/micropub.biology.000460. doi: 10.17912/micropub.biology.000460. eCollection 2021."

Proper citation: RRID:WB-STRAIN:WBStrain00051688 Copy   


  • RRID:WB-STRAIN:WBStrain00051728

http://www.wormbase.org/db/get?name=WBStrain00051728

Source Database: WormBase (WB)
Availability: unknown
Source References: EMPTY
Synonyms: peIs580.
Notes: peIs580 [ins-1p(short)::casp1 + ins-1p(short)::Venus + unc-122p::GFP]. AIA neurons are ablated by specific expression of caspase. Reference: Kunitomo H, et al., 2013, Nat Commun. 2013;4:2210. doi: 10.1038/ncomms3210.

Proper citation: RRID:WB-STRAIN:WBStrain00051728 Copy   


  • RRID:WB-STRAIN:WBStrain00051727

http://www.wormbase.org/db/get?name=WBStrain00051727

Source Database: WormBase (WB)
Availability: unknown
Source References: EMPTY
Synonyms: peIs579.
Notes: peIs579 [ttx-3p::casp1 + ttx-3p::Venus + lin-44p::GFP]. AIY neurons are ablated by specific expression of caspase. Reference: Kunitomo H, et al., 2013, Nat Commun. 2013;4:2210. doi: 10.1038/ncomms3210.

Proper citation: RRID:WB-STRAIN:WBStrain00051727 Copy   


  • RRID:WB-STRAIN:WBStrain00051725

http://www.wormbase.org/db/get?name=WBStrain00051725

Source Database: WormBase (WB)
Affected Genes: WBGene00000528(clh-1)
Genomic Alteration: WBGene00000528(clh-1)
Availability: unknown
Source References: EMPTY
Synonyms: clh-1(pe577) II.
Notes: Made_by: Park C.|"pe577 mutants exhibit defects in salt chemotaxis after low salt concentration with food conditioning. Reference: Park C, et al. Elife. 2021 Jan 25;10:e55701. doi: 10.7554/eLife.55701. PMID: 33492228"

Proper citation: RRID:WB-STRAIN:WBStrain00051725 Copy   


  • RRID:WB-STRAIN:WBStrain00051729

http://www.wormbase.org/db/get?name=WBStrain00051729

Source Database: WormBase (WB)
Affected Genes: WBGene00001648(goa-1)
Genomic Alteration: WBGene00001648(goa-1)
Availability: unknown
Source References: EMPTY
Synonyms: goa-1(pe773) I.
Notes: Made_by: Sakai N.|"This strain shows a preference for high salt concentration when conditioned with food. Reference: Ohno H, et al. Cell Rep. 2017 Sep 5;20(10):2294-2303. PMID: 28877465"

Proper citation: RRID:WB-STRAIN:WBStrain00051729 Copy   


http://www.wormbase.org/db/get?name=WBStrain00051676

Source Database: WormBase (WB)
Affected Genes: WBGene00001073(dpy-11)|WBGene00006761(unc-24)|WBGene00008140(xpf-1)|WBGene00009186(trcs-1)
Genomic Alteration: WBGene00001073(dpy-11), WBGene00006761(unc-24), WBGene00008140(xpf-1), WBGene00009186(trcs-1)
Availability: unknown
Source References: EMPTY
Synonyms: xpf-1(e1487) II; unc-24(e138) trcs-1(t1909)/nT1[let (m435)] IV; dpy-11(e224)/nT1[let (m435)] V.
Notes: him-9 is other name for xpf-1|"Leaky temperature-sensitive maternal effect lethal mutation linked to unc-24(e138) and pseudolinked to dpy-11(e224), and balanced by recessive lethal translocation. Heterozygotes are WT and segregate WT, arrested nT1 aneuploids, arrested nT1 homozygotes, and viable DpyUnc t1909 homozygotes that produce dead eggs at restrictive temperature. GE2512 is also homozygous for him-9(e1487) so that male progeny are segregated. Pick WT and check for correct segregation of progeny to maintain. Please reference Li-Leger et al., G3 11(12) 2021 in any work resulting from use of this mutation."|"Leaky temperature-sensitive maternal effect lethal mutation linked to unc-24(e138) and pseudolinked to dpy-11(e224), and balanced by recessive lethal translocation. Heterozygotes are WT and segregate WT, arrested nT1 aneuploids, arrested nT1 homozygotes, and viable DpyUnc t1909 homozygotes that produce dead eggs at restrictive temperature. GE2512 is also homozygous for xpf-1(e1487) so that male progeny are segregated. Pick WT and check for correct segregation of progeny to maintain. Please reference Li-Leger et al., G3 11(12) 2021 in any work resulting from use of this mutation. xpf-1 previously known as him-9."|"Made_by: Vancouver KO Group"

Proper citation: RRID:WB-STRAIN:WBStrain00051676 Copy   


http://www.wormbase.org/db/get?name=WBStrain00051675

Source Database: WormBase (WB)
Affected Genes: WBGene00001073(dpy-11)|WBGene00006761(unc-24)|WBGene00008140(xpf-1)|WBGene00016955(perm-5)
Genomic Alteration: WBGene00001073(dpy-11), WBGene00006761(unc-24), WBGene00008140(xpf-1), WBGene00016955(perm-5)
Availability: unknown
Source References: EMPTY
Synonyms: xpf-1(e1487) II; unc-24(e138) perm-5(t1900)/nT1[let (m435)] IV; dpy-11(e224)/nT1[let (m435)] V.
Notes: him-9 is other name for xpf-1|"Made_by: Vancouver KO Group"|"Maternal effect lethal mutation linked to unc-24(e138) and pseudolinked to dpy-11(e224), and balanced by recessive lethal translocation. Heterozygotes are WT and segregate WT, arrested nT1 aneuploids, arrested nT1 homozygotes, and viable DpyUnc t1900 homozygotes that produce dead embryos. GE2453 is also homozygous for him-9(e1487) so that male progeny are segregated. Pick WT and check for correct segregation of progeny to maintain. Please reference Li-Leger et al., G3 11(12) 2021 in any work resulting from use of this mutation."|"Maternal effect lethal mutation linked to unc-24(e138) and pseudolinked to dpy-11(e224), and balanced by recessive lethal translocation. Heterozygotes are WT and segregate WT, arrested nT1 aneuploids, arrested nT1 homozygotes, and viable DpyUnc t1900 homozygotes that produce dead embryos. GE2453 is also homozygous for xpf-1(e1487) so that male progeny are segregated. Pick WT and check for correct segregation of progeny to maintain. Please reference Li-Leger et al., G3 11(12) 2021 in any work resulting from use of this mutation. xpf-1 previously known as him-9."

Proper citation: RRID:WB-STRAIN:WBStrain00051675 Copy   


http://www.wormbase.org/db/get?name=WBStrain00051673

Source Database: WormBase (WB)
Affected Genes: WBGene00001073(dpy-11)|WBGene00006761(unc-24)|WBGene00008140(xpf-1)|WBGene00016955(perm-5)
Genomic Alteration: WBGene00001073(dpy-11), WBGene00006761(unc-24), WBGene00008140(xpf-1), WBGene00016955(perm-5)
Availability: unknown
Source References: EMPTY
Synonyms: xpf-1(e1487) II; unc-24(e138) perm-5(t1932)/nT1[let (m435)] IV; dpy-11(e224)/nT1[let (m435)] V.
Notes: him-9 is other name for xpf-1|"Made_by: Vancouver KO Group"|"Maternal effect lethal mutation linked to unc-24(e138) and pseudolinked to dpy-11(e224), and balanced by recessive lethal translocation. Heterozygotes are WT and segregate WT, arrested nT1 aneuploids, arrested nT1 homozygotes, and viable DpyUnc t1932 homozygotes that produce dead embryos. GE2391 is also homozygous for him-9(e1487) so that male progeny are segregated. Pick WT and check for correct segregation of progeny to maintain. Please reference Li-Leger et al., G3 11(12) 2021 in any work resulting from use of this mutation."|"Maternal effect lethal mutation linked to unc-24(e138) and pseudolinked to dpy-11(e224), and balanced by recessive lethal translocation. Heterozygotes are WT and segregate WT, arrested nT1 aneuploids, arrested nT1 homozygotes, and viable DpyUnc t1932 homozygotes that produce dead embryos. GE2391 is also homozygous for xpf-1(e1487) so that male progeny are segregated. Pick WT and check for correct segregation of progeny to maintain. Please reference Li-Leger et al., G3 11(12) 2021 in any work resulting from use of this mutation. xpf-1 previously known as him-9."

Proper citation: RRID:WB-STRAIN:WBStrain00051673 Copy   


  • RRID:WB-STRAIN:WBStrain00051713

    This resource has 1+ mentions.

http://www.wormbase.org/db/get?name=WBStrain00051713

Source Database: WormBase (WB)
Availability: unknown
Source References: PMID:34865044
Synonyms: osIs158 II.
Notes: Made_by: Takefumi Negishi|"osIs158 [eft-3p::AtTIR1(F79G)::mRuby] II. Single copy insertion into ttTi5605 on LG II. This strain expresses the improved version of TIR1 used for improved auxin-inducible degradation (AID2) technology. Reference: Negishi T, et al. Genetics. 2021 Dec 2;iyab218. doi: 10.1093/genetics/iyab218."

Proper citation: RRID:WB-STRAIN:WBStrain00051713 Copy   


http://www.wormbase.org/db/get?name=WBStrain00051679

Source Database: WormBase (WB)
Affected Genes: WBGene00001078(dpy-19)|WBGene00001609(glp-1)|WBGene00001862(him-3)|WBGene00006768(unc-32)|WBGene00022803(ZK688.9)
Genomic Alteration: WBGene00001078(dpy-19), WBGene00001609(glp-1), WBGene00001862(him-3), WBGene00006768(unc-32), WBGene00022803(ZK688.9)
Availability: unknown
Source References: EMPTY
Synonyms: unc-32(e189) ZK688.9(t1587)/qC1[dpy-19(1259) glp-1(q339)] III; him-3(e1147) IV.
Notes: Made_by: Vancouver KO Group|"Maternal-effect lethal mutation linked to unc-32(e189) and balanced by glp-1- and dpy-19-marked recombination suppressor. Heterozygotes are WT, and segregate WT, sterile ts-Dpy qC1 homozygotes, and viable Unc t1587 homozygotes that produce arrested embryos. GE2621 is also homozygous for him-3(e1147) so that male progeny are segregated. Pick WT and check for correct segregation of progeny to maintain. Please reference Li-Leger et al., G3 11(12) 2021 in any work resulting from use of this mutation."

Proper citation: RRID:WB-STRAIN:WBStrain00051679 Copy   


http://www.wormbase.org/db/get?name=WBStrain00051678

Source Database: WormBase (WB)
Affected Genes: WBGene00001078(dpy-19)|WBGene00001609(glp-1)|WBGene00001862(him-3)|WBGene00004075(pod-1)|WBGene00006768(unc-32)
Genomic Alteration: WBGene00001078(dpy-19), WBGene00001609(glp-1), WBGene00001862(him-3), WBGene00004075(pod-1), WBGene00006768(unc-32)
Availability: unknown
Source References: EMPTY
Synonyms: unc-32(e189) pod-1(t1674)/qC1[dpy-19(1259) glp-1(q339)] III; him-3(e1147) IV.
Notes: Made_by: Vancouver KO Group|"Maternal-effect lethal mutation linked to unc-32(e189) and balanced by glp-1- and dpy-19-marked recombination suppressor. Heterozygotes are WT, and segregate WT, sterile ts-Dpy qC1 homozygotes, and viable Unc t1674 homozygotes that do not produce viable progeny. GE2605 is also homozygous for him-3(e1147) so that male progeny are segregated. Pick WT and check for correct segregation of progeny to maintain. Please reference Li-Leger et al., G3 11(12) 2021 in any work resulting from use of this mutation."

Proper citation: RRID:WB-STRAIN:WBStrain00051678 Copy   


http://www.wormbase.org/db/get?name=WBStrain00051710

Source Database: WormBase (WB)
Availability: unknown
Source References: EMPTY
Synonyms: gwIs39 III; bqSi225 IV; gwIs59.
Notes: gwIs39 [baf-1::gfp-lacI::let-858 3'UTR + vit-5::GFP] III. bqSi225 [emr-1p::emr-1::mCherry + unc-119(+)] IV. gwIs59 [pha-4::mCherry::256xLacO::4xLexA + unc-119(+)]. Superficially wild-type. Express ubiquitous EMR-1::mCherry at the nuclear periphery. Expresses GFP-LacI from early embryogenesis and throughout development, which forms a small spot at the lacO array. Worms have red intestine (all stages) and green intestine (from late L4 stage). Reference: Harr JC, et al. Genes Dev. 2020 Apr 1;34(7-8):560-579. PMID: 32139421.|"Made_by: Jennifer Harr"

Proper citation: RRID:WB-STRAIN:WBStrain00051710 Copy   


  • RRID:WB-STRAIN:WBStrain00051717

http://www.wormbase.org/db/get?name=WBStrain00051717

Source Database: WormBase (WB)
Availability: unknown
Source References: EMPTY
Synonyms: jsSi1579; wrdSi57 II.
Notes: wrdSi57 [^SEC^eft-3p:TIR1::F2A::mTagBFP2::AID*::NLS::tbb-2 3'UTR] (II:0.77). Pick Rollers to maintain. Pan-somatic expression of TIR1 co-factor for AID, and expression of AID-tagged blue protein in somatic nuclei. Self-excising cassette with Rol and HygroR markers still in strain to facilitate crosses. Heat-shock to remove SEC as described in Dickinson et al. 2015. jsSi1579 is an RMCE landing pad inserted at a sgRNA site 45 bp from the ttTi5605 insertion site. It contains an rpl-28p::GFP reporter flanked by FRT and FRT3 sites and a loxP site (for more details about landing pads, see Nonet, 2020.Genetics or visit https:

Proper citation: RRID:WB-STRAIN:WBStrain00051717 Copy   


  • RRID:WB-STRAIN:WBStrain00051714

http://www.wormbase.org/db/get?name=WBStrain00051714

Source Database: WormBase (WB)
Availability: unknown
Source References: PMID:34865044
Synonyms: ieSi58 IV; osIs182 V.
Notes: ieSi58 [eft-3p::degron::GFP::unc-54 3'UTR + Cbr-unc-119(+)] IV. osIs182 [eft-3p::AtTIR1(F79G) + LoxP + myo-2p::GFP + rps-27p::neoR + LoxP] V. ieSi58 is a single copy transgene inserted into chromosome IV (oxTi177) expressing degron::GFP in the soma. osIs182 is a single copy insertion of TIR1(F79G) into chromosome V (oxTi365) and expresses the improved version of TIR1 used for improved auxin-inducible degradation (AID2) technology. Reference: Negishi T, et al. Genetics. 2021 Dec 2;iyab218. doi: 10.1093/genetics/iyab218.|"Made_by: Takefumi Negishi"

Proper citation: RRID:WB-STRAIN:WBStrain00051714 Copy   


  • RRID:WB-STRAIN:WBStrain00051719

    This resource has 1+ mentions.

http://www.wormbase.org/db/get?name=WBStrain00051719

Source Database: WormBase (WB)
Affected Genes: WBGene00001864(him-5)
Genomic Alteration: WBGene00001864(him-5)
Availability: unknown
Source References: EMPTY
Synonyms: qIs56 him-5(e1490) V; qEx557.
Notes: qIs56 [lag-2p::GFP + unc-119(+)] V. qEx557 [hsp-16p::ceh-22b + ttx-3::DsRed]. Him. Pick DsRed+ animals to maintain qEx557 array. Heat-shock can be used to drive the ectopic expression of CEH-22B (derived from Fire Lab vector pPD49.78). LAG-2::GFP is expressed the embryo, nerve cord, Z1/Z4, and DTCs. Reference: Lam N. et al. Curr Biol. 2006 Feb 7;16(3):287-95. doi: 10.1016/j.cub.2005.12.015. PMID: 16461282

Proper citation: RRID:WB-STRAIN:WBStrain00051719 Copy   


http://www.wormbase.org/db/get?name=WBStrain00051661

Source Database: WormBase (WB)
Affected Genes: WBGene00001078(dpy-19)|WBGene00001609(glp-1)|WBGene00001862(him-3)|WBGene00006768(unc-32)|WBGene00012713(bckd-1A)
Genomic Alteration: WBGene00001078(dpy-19), WBGene00001609(glp-1), WBGene00001862(him-3), WBGene00006768(unc-32), WBGene00012713(bckd-1A)
Availability: unknown
Source References: EMPTY
Synonyms: unc-32(e189) bckd-1A(t1461)/qC1[dpy-19(1259) glp-1(q339)] III; him-3(e1147) IV.
Notes: Made_by: Vancouver KO Group|"Maternal-effect lethal mutation linked to unc-32(e189) and balanced by glp-1- and dpy-19-marked recombination suppressor. Heterozygotes are WT, and segregate WT, sterile ts-Dpy qC1 homozygotes, and viable Unc t1461 homozygotes that produce dead eggs. GE1742 is also homozygous for him-3(e1147) so that male progeny are segregated. Pick WT and check for correct segregation of progeny to maintain. Please reference Li-Leger et al., G3 11(12) 2021 in any work resulting from use of this mutation."

Proper citation: RRID:WB-STRAIN:WBStrain00051661 Copy   



Can't find your Organism?

We recommend that you click next to the search bar to check some helpful tips on searches and refine your search firstly. If you want to find a specific organism, it's easier to enter an RRID or a Catalog Number to search. You can refine the search results using Facets on the left side of the search results page. If you are on the table view, you can also search in a specific column by clicking the column title and enter the keywords.

If you still could not find your organism in the search results, please help us by registering it into the system — it's easy. Organisms identifiers are registered through multiple sources depending on the species:

Can't find the RRID you're searching for? X
  1. Neuroscience Information Framework Resources

    Welcome to the NIF Resources search. From here you can search through a compilation of resources used by NIF and see how data is organized within our community.

  2. Navigation

    You are currently on the Community Resources tab looking through categories and sources that NIF has compiled. You can navigate through those categories from here or change to a different tab to execute your search through. Each tab gives a different perspective on data.

  3. Logging in and Registering

    If you have an account on NIF then you can log in from here to get additional features in NIF such as Collections, Saved Searches, and managing Resources.

  4. Searching

    Here is the search term that is being executed, you can type in anything you want to search for. Some tips to help searching:

    1. Use quotes around phrases you want to match exactly
    2. You can manually AND and OR terms to change how we search between words
    3. You can add "-" to terms to make sure no results return with that term in them (ex. Cerebellum -CA1)
    4. You can add "+" to terms to require they be in the data
    5. Using autocomplete specifies which branch of our semantics you with to search and can help refine your search
  5. Save Your Search

    You can save any searches you perform for quick access to later from here.

  6. Query Expansion

    We recognized your search term and included synonyms and inferred terms along side your term to help get the data you are looking for.

  7. Collections

    If you are logged into NIF you can add data records to your collections to create custom spreadsheets across multiple sources of data.

  8. Sources

    Here are the sources that were queried against in your search that you can investigate further.

  9. Categories

    Here are the categories present within NIF that you can filter your data on

  10. Subcategories

    Here are the subcategories present within this category that you can filter your data on

  11. Further Questions

    If you have any further questions please check out our FAQs Page to ask questions and see our tutorials. Click this button to view this tutorial again.

X