Searching the RRID Resource Information Network
Are you sure you want to leave this community? Leaving the community will revoke any permissions you have been granted in this community.
Integrated Animals is a virtual database currently indexing available animal strains and mutants from: AGSC (Ambystoma), BCBC (mice), BDSC (flies), European Xenopus Resource Center (frog), The National Xenopus Resource (frog), Xenopus Express (frog), CWRU Cystic Fibrosis Mouse Models (mice), DGGR (flies), FlyBase (flies), IMSR (mice), MGI (mice), MMRRC (mice), NSRRC (pig), RGD (rats), Sperm Stem Cell Libraries for Biological Research (rats), Tetrahymena Stock Center (Tetrahymena), WormBase (worms), XGSC (Xiphophorus), ZFIN (zebrafish), and ZIRC (zebrafish). Note, the IMSR data is linked, but users may need to re-execute the search if the top mouse is not returned properly.
Note: BCBC is no longer in service, so the links may not be functional.
| Organism Name | Proper Citation | Species | Synonyms |
Notes |
Phenotype | Affected Gene | ||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
|
RB2366 Resource Report Resource Website |
RRID:WB-STRAIN:WBStrain00033042 | Caenorhabditis elegans | T12B3.4(ok3212) IV. | Made_by: OMRF Knockout Group|"T12B3.4 Homozygous. Outer Left Sequence: gatggctccagaagacgttc. Outer Right Sequence: cactgaaaaatgtgcgtggt. Inner Left Sequence: tttttgttgggtccttcttttt. Inner Right Sequence: tgatatcttggcatttggga. Inner Primer PCR Length: 1166. Deletion size: about 600 bp."|"This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use." | WBGene00020447(mob-3) | WBGene00020447(mob-3) | WB-STRAIN:WBStrain00033042 | WormBase (WB) | WB | available | WB-STRAIN:RB2366, CGC_RB2366 | 2026-08-29 09:21:52 | 0 | |||
|
RB2367 Resource Report Resource Website |
RRID:WB-STRAIN:WBStrain00033043 | Caenorhabditis elegans | srh-49(ok3217) I. | C10G11.4 Homozygous. Outer Left Sequence: caatgtccttcccaacatca. Outer Right Sequence: ttaatttttgaattcgcccg. Inner Left Sequence: caagattattatgctacaaactacacg. Inner Right Sequence: gttccagcatctctcctcgt. Inner Primer PCR Length: 1357. Deletion size: about 500bp.|"Made_by: OMRF Knockout Group"|"This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use." | WBGene00005272(srh-49) | WBGene00005272(srh-49) | WB-STRAIN:WBStrain00033043 | WormBase (WB) | WB | available | WB-STRAIN:RB2367, CGC_RB2367 | 2026-08-29 09:21:52 | 0 | |||
|
RB2368 Resource Report Resource Website |
RRID:WB-STRAIN:WBStrain00033044 | Caenorhabditis elegans | R03G8.6(ok3218) X. | Made_by: OMRF Knockout Group|"R03G8.6 Homozygous. Outer Left Sequence: tgacatacgactcgacccaa. Outer Right Sequence: cggttttcaattgcgttttt. Inner Left Sequence: cggtccctagtaagctccaa. Inner Right Sequence: tgttgattttgcaaccgaaa. Inner Primer PCR Length: 1289. Deletion size: about 500 bp."|"This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use." | WBGene00011000(R03G8.6) | WBGene00011000(R03G8.6) | WB-STRAIN:WBStrain00033044 | WormBase (WB) | WB | available | WB-STRAIN:RB2368, CGC_RB2368 | 2026-08-29 09:21:52 | 0 | |||
|
RB2370 Resource Report Resource Website |
RRID:WB-STRAIN:WBStrain00033046 | Caenorhabditis elegans | T21B6.5(ok3220) X. | Made_by: OMRF Knockout Group|"T21B6.5 Homozygous. Outer Left Sequence: tgagcaatggattacaaccg. Outer Right Sequence: atgtccggagcttaatggtg. Inner Left Sequence: tgcgcggtaattggaaat. Inner Right Sequence: gagcactatcagtgggggaa. Inner Primer PCR Length: 1365. Deletion size: about 600 bp."|"This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use." | WBGene00011882(nstp-9) | WBGene00011882(nstp-9) | WB-STRAIN:WBStrain00033046 | WormBase (WB) | WB | available | WB-STRAIN:RB2370, CGC_RB2370 | 2026-08-29 09:21:52 | 0 | |||
|
RB2371 Resource Report Resource Website |
RRID:WB-STRAIN:WBStrain00033047 | Caenorhabditis elegans | nhl-3(ok3223) II. | Made_by: OMRF Knockout Group|"This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use."|"W04H10.3 Homozygous. Outer Left Sequence: cacgtagcttcgggtcattt. Outer Right Sequence: aagaaatttgcattggagcg. Inner Left Sequence: agtctagcagatccacatggc. Inner Right Sequence: gtgacgccagcacattctta. Inner Primer PCR Length: 1246. Deletion size: about 500 bp." | WBGene00003599(nhl-3) | WBGene00003599(nhl-3) | WB-STRAIN:WBStrain00033047 | WormBase (WB) | WB | available | WB-STRAIN:RB2371, CGC_RB2371 | 2026-08-29 09:21:52 | 0 | |||
|
RB2372 Resource Report Resource Website |
RRID:WB-STRAIN:WBStrain00033048 | Caenorhabditis elegans | K06A1.5(ok3224) II. | K06A1.5 Homozygous. Outer Left Sequence: ccgcagatccagatatgaca. Outer Right Sequence: tttctcgtacgcattgcatc. Inner Left Sequence: ccgtatggccagaaaacgta. Inner Right Sequence: ttgcaagacatgtgcaatagg. Inner Primer PCR Length: 1190. Deletion size: about 600 bp.|"Made_by: OMRF Knockout Group"|"This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use." | WBGene00019427(atg-16.2) | WBGene00019427(atg-16.2) | WB-STRAIN:WBStrain00033048 | WormBase (WB) | WB | available | PMID:39570954 | WB-STRAIN:RB2372, CGC_RB2372 | 2026-08-29 09:21:52 | 0 | ||
|
RB2374 Resource Report Resource Website 1+ mentions |
RRID:WB-STRAIN:WBStrain00033049 | Caenorhabditis elegans | cnc-2(ok3226) V. | Made_by: OMRF Knockout Group|"R09B5.3 Homozygous. Outer Left Sequence: accactcctttggtctcgaa. Outer Right Sequence: tcgacgtcatcatttggttc. Inner Left Sequence: ttttggaagtcgaccgaaac. Inner Right Sequence: catatcagttgtgagtatcaatggaa. Inner Primer PCR Length: 1164. Deletion size: about 600 bp."|"This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use." | WBGene00000556(cnc-2) | WBGene00000556(cnc-2) | WB-STRAIN:WBStrain00033049 | WormBase (WB) | WB | available | WB-STRAIN:RB2374, CGC_RB2374 | 2026-08-29 09:21:52 | 2 | |||
|
RB2377 Resource Report Resource Website |
RRID:WB-STRAIN:WBStrain00033052 | Caenorhabditis elegans | R07B7.11(ok3230) V. | Made_by: OMRF Knockout Group|"R07B7.11 Homozygous. Outer Left Sequence: ttggtcggaaatggaaagag. Outer Right Sequence: tctccgaaatcaaatcgtcc. Inner Left Sequence: cagtggaatgaaggctttgg. Inner Right Sequence: ttgagactgttctctttcaaattca. Inner Primer PCR Length: 1197. Deletion size: about 700 bp."|"This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use." | WBGene00011095(gana-1) | WBGene00011095(gana-1) | WB-STRAIN:WBStrain00033052 | WormBase (WB) | WB | available | WB-STRAIN:RB2377, CGC_RB2377 | 2026-08-29 09:21:52 | 0 | |||
|
RB2378 Resource Report Resource Website 1+ mentions |
RRID:WB-STRAIN:WBStrain00033053 | Caenorhabditis elegans | msh-6(ok3231) I. | Made_by: OMRF Knockout Group|"This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use."|"Y47G6A.11 Homozygous. Outer Left Sequence: accgctaggattttcggatt. Outer Right Sequence: gcccctgagttgcaaaatta. Inner Left Sequence: tggtattcggtatcaggagca. Inner Right Sequence: gcctctttcctgtgcacttt. Inner Primer PCR Length: 1282. Deletion size: about 400 bp." | WBGene00003422(msh-6) | WBGene00003422(msh-6) | WB-STRAIN:WBStrain00033053 | WormBase (WB) | WB | available | WB-STRAIN:RB2378, CGC_RB2378 | 2026-08-29 09:21:52 | 1 | |||
|
RB2386 Resource Report Resource Website 1+ mentions |
RRID:WB-STRAIN:WBStrain00033061 | Caenorhabditis elegans | C37H5.3(ok3245) V. | C37H5.3 Homozygous. Outer Left Sequence: gtagatcatctcgccccaaa. Outer Right Sequence: atatttctcgccctgccttc. Inner Left Sequence: catcagacccagaaactgcc. Inner Right Sequence: aatttgctggccaggtgtat. Inner Primer PCR Length: 1379. Deletion size: about 800 bp.|"Made_by: OMRF Knockout Group"|"This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use."|"WBStrain provided so WBPaper00060484 paper added based on AFP_Strain data." | WBGene00016507(abhd-5.2) | WBGene00016507(abhd-5.2) | WB-STRAIN:WBStrain00033061 | WormBase (WB) | WB | available | PMID:33034119 | WB-STRAIN:RB2386, CGC_RB2386 | 2026-08-29 09:21:52 | 1 | ||
|
RB2387 Resource Report Resource Website |
RRID:WB-STRAIN:WBStrain00033062 | Caenorhabditis elegans | R05H5.7(ok3246) II. | Made_by: OMRF Knockout Group|"R05H5.7 Homozygous. Outer Left Sequence: cgaagttttgagcttttggc. Outer Right Sequence: tcgaaaagaccgaattgctt. Inner Left Sequence: tttgattttaattgtggtaactacgg. Inner Right Sequence: ggtcacaggtgtgttgtgct. Inner Primer PCR Length: 1120. Deletion size: about 700 bp."|"This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use." | WBGene00011041(R05H5.7) | WBGene00011041(R05H5.7) | WB-STRAIN:WBStrain00033062 | WormBase (WB) | WB | available | WB-STRAIN:RB2387, CGC_RB2387 | 2026-08-29 09:21:52 | 0 | |||
|
RB2388 Resource Report Resource Website |
RRID:WB-STRAIN:WBStrain00033063 | Caenorhabditis elegans | W04G3.1(ok3253) X. | Made_by: OMRF Knockout Group|"This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use."|"W04G3.1 Homozygous. Outer Left Sequence: aacgcattgaaccccactta. Outer Right Sequence: agctaacccaattctcgcct. Inner Left Sequence: caccgtgccctaattactca. Inner Right Sequence: actagtgcgccctacaggag. Inner Primer PCR Length: 1191. Deletion size: about 700 bp." | WBGene00012255(lpr-6) | WBGene00012255(lpr-6) | WB-STRAIN:WBStrain00033063 | WormBase (WB) | WB | available | WB-STRAIN:RB2388, CGC_RB2388 | 2026-08-29 09:21:52 | 0 | |||
|
RB2466 Resource Report Resource Website |
RRID:WB-STRAIN:WBStrain00033141 | Caenorhabditis elegans | F28D1.2(ok3406) IV. | F28D1.2 Homozygous. Outer Left Sequence: cctcttctccctcctcatca. Outer Right Sequence: tcatttcactcgcacaggtc. Inner Left Sequence: ttcaacctcgtagttctcctcc. Inner Right Sequence: cgactggttgtcaccctttt. Inner Primer PCR Length: 1189. Deletion size: about 400 bp.|"Made_by: OMRF Knockout Group"|"This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use." | WBGene00009212(atz-1) | WBGene00009212(atz-1) | WB-STRAIN:WBStrain00033141 | WormBase (WB) | WB | available | WB-STRAIN:RB2466, CGC_RB2466 | 2026-08-29 09:21:54 | 0 | |||
|
RB2472 Resource Report Resource Website |
RRID:WB-STRAIN:WBStrain00033147 | Caenorhabditis elegans | ZK970.1(ok3412) II. | Made_by: OMRF Knockout Group|"This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use."|"ZK970.1 Homozygous. Outer Left Sequence: acgaatcgaatggaatctgc. Outer Right Sequence: attgttttgggcaggagttg. Inner Left Sequence: ttatgtgctggaaccgaaatc. Inner Right Sequence: gcaacttcctatccttctggc. Inner Primer PCR Length: 1112. Deletion size: about 500 bp." | WBGene00014171(nep-26) | WBGene00014171(nep-26) | WB-STRAIN:WBStrain00033147 | WormBase (WB) | WB | available | WB-STRAIN:RB2472, CGC_RB2472 | 2026-08-29 09:21:54 | 0 | |||
|
RB2476 Resource Report Resource Website 1+ mentions |
RRID:WB-STRAIN:WBStrain00033151 | Caenorhabditis elegans | tig-2(ok3416) V. | F39G3.8 Homozygous. Outer Left Sequence: gagttgtggaggcggatcta. Outer Right Sequence: agtgtttccagacaggccac. Inner Left Sequence: tcagagctttagcggcaaat. Inner Right Sequence: aacaaatccgcgagctctt. Inner Primer PCR Length: 1207. Deletion size: about 800 bp.|"Made_by: OMRF Knockout Group"|"This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use." | WBGene00006570(tig-2) | WBGene00006570(tig-2) | WB-STRAIN:WBStrain00033151 | WormBase (WB) | WB | available | WB-STRAIN:RB2476, CGC_RB2476 | 2026-08-29 09:21:54 | 3 | |||
|
RB2477 Resource Report Resource Website |
RRID:WB-STRAIN:WBStrain00033152 | Caenorhabditis elegans | tmd-2(ok3417) V. | C08D8.2 Homozygous. Outer Left Sequence: ttacagaggcaatgcacgag. Outer Right Sequence: aaccggggatatcatcacaa. Inner Left Sequence: ccgaattgtttcttgggatg. Inner Right Sequence: tacaatccgttgcgtcaaaa. Inner Primer PCR Length: 1182. Deletion size: about 800 bp.|"Made_by: OMRF Knockout Group"|"This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use." | WBGene00006582(tmd-2) | WBGene00006582(tmd-2) | WB-STRAIN:WBStrain00033152 | WormBase (WB) | WB | available | WB-STRAIN:RB2477, CGC_RB2477 | 2026-08-29 09:21:54 | 0 | |||
|
RB2480 Resource Report Resource Website |
RRID:WB-STRAIN:WBStrain00033155 | Caenorhabditis elegans | T02G5.3(ok3420) II. | Made_by: OMRF Knockout Group|"T02G5.3 Homozygous. Outer Left Sequence: ccgaatgcctgaatatcaca. Outer Right Sequence: tcgtcctcttccacttttgg. Inner Left Sequence: tctaactatgctcggccacc. Inner Right Sequence: tccgagaccggctaccttat. Inner Primer PCR Length: 1158. Deletion size: about 500bp."|"This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use." | WBGene00020163(T02G5.3) | WBGene00020163(T02G5.3) | WB-STRAIN:WBStrain00033155 | WormBase (WB) | WB | available | WB-STRAIN:RB2480, CGC_RB2480 | 2026-08-29 09:21:54 | 0 | |||
|
RB2483 Resource Report Resource Website |
RRID:WB-STRAIN:WBStrain00033158 | Caenorhabditis elegans | Y48A6B.8(ok3423) III. | Made_by: OMRF Knockout Group|"This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use."|"Y48A6B.8 Homozygous. Outer Left Sequence: cggagacatcatgctcattg. Outer Right Sequence: gggacagcacagacagatca. Inner Left Sequence: gaccggttgcactgtaatga. Inner Right Sequence: aaatgggcaacgttgtgaag. Inner Primer PCR Length: 1237. Deletion size: about 700 bp." | WBGene00012969(Y48A6B.8) | WBGene00012969(Y48A6B.8) | WB-STRAIN:WBStrain00033158 | WormBase (WB) | WB | available | WB-STRAIN:RB2483, CGC_RB2483 | 2026-08-29 09:21:54 | 0 | |||
|
RB2485 Resource Report Resource Website 1+ mentions |
RRID:WB-STRAIN:WBStrain00033160 | Caenorhabditis elegans | Y9C9A.16(ok3440) IV. | Made_by: OMRF Knockout Group|"This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use."|"Y9C9A.16 Homozygous. Outer Left Sequence: gtcgacagttttcaagtgcg. Outer Right Sequence: ctcgaaaacttccaagtggc. Inner Left Sequence: tgatgcagctgtttttgcat. Inner Right Sequence: tgtcggtggaggtctaatga. Inner Primer PCR Length: 1187. Deletion size: about 400 bp." | WBGene00021183(Y9C9A.16) | WBGene00021183(Y9C9A.16) | WB-STRAIN:WBStrain00033160 | WormBase (WB) | WB | available | WB-STRAIN:RB2485, CGC_RB2485 | 2026-08-29 09:21:54 | 1 | |||
|
RB2447 Resource Report Resource Website |
RRID:WB-STRAIN:WBStrain00033122 | Caenorhabditis elegans | str-220(ok3374) IV. | C42D4.9 Homozygous. Outer Left Sequence: tgtaacacggcaggttcaaa. Outer Right Sequence: acattccgttttccatttgc. Inner Left Sequence: ttggcgccacttcttcttta. Inner Right Sequence:ccagactgtccaaaatccaga . Inner Primer PCR Length: 1146. Deletion size: about 300 bp.|"Made_by: OMRF Knockout Group"|"This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use." | WBGene00006251(str-220) | WBGene00006251(str-220) | WB-STRAIN:WBStrain00033122 | WormBase (WB) | WB | available | WB-STRAIN:RB2447, CGC_RB2447 | 2026-08-29 09:21:53 | 0 |
Can't find your Organism?
We recommend that you click next to the search bar to check some helpful tips on searches and refine your search firstly. If you want to find a specific organism, it's easier to enter an RRID or a Catalog Number to search. You can refine the search results using Facets on the left side of the search results page. If you are on the table view, you can also search in a specific column by clicking the column title and enter the keywords.
If you still could not find your organism in the search results, please help us by registering it into the system — it's easy. Organisms identifiers are registered through multiple sources depending on the species:
Welcome to the NIF Resources search. From here you can search through a compilation of resources used by NIF and see how data is organized within our community.
You are currently on the Community Resources tab looking through categories and sources that NIF has compiled. You can navigate through those categories from here or change to a different tab to execute your search through. Each tab gives a different perspective on data.
If you have an account on NIF then you can log in from here to get additional features in NIF such as Collections, Saved Searches, and managing Resources.
Here is the search term that is being executed, you can type in anything you want to search for. Some tips to help searching:
If you are logged into NIF you can add data records to your collections to create custom spreadsheets across multiple sources of data.
Here are the facets that you can filter the data by.
If you have any further questions please check out our FAQs Page to ask questions and see our tutorials. Click this button to view this tutorial again.
Welcome to the Neuroscience Information Framework Project, designed to serve the biomedical research community. NIF maintains the largest searchable collection of neuroscience data, the largest catalog of biomedical resources, and the largest ontology for neuroscience on the web. We welcome all feedback and suggestions and are actively looking for resource providers to make their resources accessible through NIF. Learn about the tools available to help you share your data and discover a dynamic inventory of Web-based neuroscience resources.
