Searching the RRID Resource Information Network
Are you sure you want to leave this community? Leaving the community will revoke any permissions you have been granted in this community.
Integrated Animals is a virtual database currently indexing available animal strains and mutants from: AGSC (Ambystoma), BCBC (mice), BDSC (flies), European Xenopus Resource Center (frog), The National Xenopus Resource (frog), Xenopus Express (frog), CWRU Cystic Fibrosis Mouse Models (mice), DGGR (flies), FlyBase (flies), IMSR (mice), MGI (mice), MMRRC (mice), NSRRC (pig), RGD (rats), Sperm Stem Cell Libraries for Biological Research (rats), Tetrahymena Stock Center (Tetrahymena), WormBase (worms), XGSC (Xiphophorus), ZFIN (zebrafish), and ZIRC (zebrafish). Note, the IMSR data is linked, but users may need to re-execute the search if the top mouse is not returned properly.
Note: BCBC is no longer in service, so the links may not be functional.
http://www.wormbase.org/db/get?name=WBStrain00055268
Source Database: WormBase (WB)
Availability: unknown
Source References: EMPTY
Synonyms: syIs690; syIs300
Notes: Made_by: Chun-Hao Chen/Stephanie Nava|"syIs690 [tph-1p::NLS::cGAL(DBD)::gp41-1-N-intein::let-858 3'UTR +pdf-1p::NLS::gp41-1-C-intein::cGAL(AD)::let-858 3'UTR + unc-122p::RFP + 1kb DNA ladder (NEB)]. [NOTE: Pick animals with RFP+ coelomocytes to maintain. Array appears to be lost or silenced in some animals.] Split cGAL driver for NSM neuron. syIs300 [15xUAS::(delta)pes-10::GFP::let-858 3'UTR + ttx-3p::RFP + 1kb DNA ladder(NEB)] is a GFP cGAL effector. Some worms do not express ttx-3p::RFP marker, but will consistently produce worms with the transgenic marker in next generation."
Proper citation: RRID:WB-STRAIN:WBStrain00055268 Copy
http://www.wormbase.org/db/get?name=WBStrain00055301
Source Database: WormBase (WB)
Affected Genes: WBGene00000683(col-109)
Genomic Alteration: WBGene00000683(col-109)
Availability: unknown
Source References: EMPTY
Synonyms: col-109(sy1744) IV.
Notes: Made_by: Heenam Park|"Superficially wild-type. CRISPR/Cas9 engineered STOP-IN null mutant of col-109. Universal 43 bp-long knock-in insertion with 3-frame stop codon (STOP-IN cassette). left flanking sequence: gatcaccttttcccccattcgttttttccagTC right flanking sequence: GACCGCCAGAGATATCATGTCTGAAATCAGTCACAAG inserted sequence between the two flanking sequence (STOP-IN cassette): GGGAAGTTTGTCCAGAGCAGAGGTGACTAAGTGATAAgctagc. sgRNA: TGATATCTCTGGCGGTCGAC Method Reference: G3 (Bethesda).2018 Nov 6;8(11):3607-3616"
Proper citation: RRID:WB-STRAIN:WBStrain00055301 Copy
http://www.wormbase.org/db/get?name=WBStrain00055304
Source Database: WormBase (WB)
Affected Genes: WBGene00005205(srg-48)
Genomic Alteration: WBGene00005205(srg-48)
Availability: unknown
Source References: EMPTY
Synonyms: srg-48(sy1750) IV.
Notes: Made_by: Heenam Park|"Superficially wild-type. CRISPR/Cas9 engineered STOP-IN null mutant of srg-48. Universal 43 bp-long knock-in insertion with 3-frame stop codon (STOP-IN cassette). left flanking sequence: CATTCTCCAGAACTATTCAATTTCTTCATGTTTTGCG right flanking sequence: GGCTGGCATTTCTTCATCTTCAGTCATGTAGTTC inserted sequence between the two flanking sequence (STOP-IN cassette): GGGAAGTTTGTCCAGAGCAGAGGTGACTAAGTGATAAgctagc. sgRNA: TTTCTTCATGTTTTGCGGGC Method Reference: G3 (Bethesda).2018 Nov 6;8(11):3607-3616"
Proper citation: RRID:WB-STRAIN:WBStrain00055304 Copy
http://www.wormbase.org/db/get?name=WBStrain00055306
Source Database: WormBase (WB)
Affected Genes: WBGene00008570(kcnl-2)
Genomic Alteration: WBGene00008570(kcnl-2)
Availability: unknown
Source References: EMPTY
Synonyms: kcnl-2(sy1754) I.
Notes: Made_by: Heenam Park|"Superficially wild-type. CRISPR/Cas9 engineered STOP-IN null mutant of kcnl-2. Universal 43 bp-long knock-in insertion with 3-frame stop codon (STOP-IN cassette) into very 1st exon of the gene. left flanking sequence: GTGATGTAAACGAAATTCCAAAAACGAATGGAGG right flanking sequence: AGGACATCCAATTGTTAGAAGAAAAAGTGGAATG inserted sequence between the two flanking sequence (STOP-IN cassette): GGGAAGTTTGTCCAGAGCAGAGGTGACTAAGTGATAAgctagc. sgRNA: CCAAAAACGAATGGAGGTCC Method Reference: G3 (Bethesda).2018 Nov 6;8(11):3607-3616"
Proper citation: RRID:WB-STRAIN:WBStrain00055306 Copy
http://www.wormbase.org/db/get?name=WBStrain00055305
Source Database: WormBase (WB)
Affected Genes: WBGene00005739(srv-28)
Genomic Alteration: WBGene00005739(srv-28)
Availability: unknown
Source References: EMPTY
Synonyms: srv-28(sy1752) IV.
Notes: Made_by: Heenam Park|"Superficially wild-type. CRISPR/Cas9 engineered STOP-IN null mutant of srv-28. Universal 43 bp-long knock-in insertion with 3-frame stop codon (STOP-IN cassette). left flanking sequence: GTATACTATGGAATGTCGATTTTAAGTCTTCCCTTATA right flanking sequence: CTTTGGTGTTCTCATTTGTTTGTTGAGATTGAG inserted sequence between the two flanking sequence (STOP-IN cassette): GGGAAGTTTGTCCAGAGCAGAGGTGACTAAGTGATAAgctagc. sgRNA: TTAAGTCTTCCCTTATACTT Method Reference: G3 (Bethesda).2018 Nov 6;8(11):3607-3616"
Proper citation: RRID:WB-STRAIN:WBStrain00055305 Copy
http://www.wormbase.org/db/get?name=WBStrain00055270
Source Database: WormBase (WB)
Affected Genes: WBGene00017483(lgc-22)
Genomic Alteration: WBGene00017483(lgc-22)
Availability: unknown
Source References: EMPTY
Synonyms: lgc-22(sy1478) IV.
Notes: Made_by: Heenam Park & Mandy Tan|"Superficially wild-type. CRISPR/Cas9 engineered STOP-IN null mutant of lgc-22. Universal 43 bp-long knock-in insertion with 3-frame stop codon (STOP-IN cassette). left flanking sequence: GGCTTCTCATTGCCACGTCACTGGCCGCCACGTTA right flanking sequence: GCGTGGGCGGCGGGCACCGCCGGCGGCTGCGAGGAC inserted sequence between the two flanking sequence (STOP-IN cassette): GGGAAGTTTGTCCAGAGCAGAGGTGACTAAGTGATAAgctagc. sgRNA: CACTGGCCGCCACGTTAGCG Method Reference: G3 (Bethesda).2018 Nov 6;8(11):3607-3616"
Proper citation: RRID:WB-STRAIN:WBStrain00055270 Copy
http://www.wormbase.org/db/get?name=WBStrain00055256
Source Database: WormBase (WB)
Availability: unknown
Source References: PMID:38096407
Synonyms: syIs654.
Notes: Made_by: Jun Young Oh/Stephanie Nava|"syIs654 [15xUAS:VSFP-Butterfly-1-2::let-858 3'UTR + ttx-3p::RFP + 1kb DNA ladder (NEB)]. Voltage-sensitive fluorescent protein cGAL effector."
Proper citation: RRID:WB-STRAIN:WBStrain00055256 Copy
http://www.wormbase.org/db/get?name=WBStrain00055255
Source Database: WormBase (WB)
Availability: unknown
Source References: PMID:38096407
Synonyms: syIs640.
Notes: Made_by: Chun-Hao Chen/Stephanie Nava|"syIs640 [15xUAS::fem-3::mCherry::let-858 3'UTR + ttx-3p:RFP + 1kb DNA ladder (NEB)] cGAL effector to induce masculinization"
Proper citation: RRID:WB-STRAIN:WBStrain00055255 Copy
http://www.wormbase.org/db/get?name=WBStrain00055257
Source Database: WormBase (WB)
Availability: unknown
Source References: PMID:38096407
Synonyms: syIs657.
Notes: Made_by: Jun Young Oh/Stephanie Nava|"syIs657 [15xUAS::act-2::Venus::let-858 3'UTR + ttx-3p::RFP + 1kb DNA ladder (NEB)]. cGAL effector for localiziation of actin filament and cell cortex"
Proper citation: RRID:WB-STRAIN:WBStrain00055257 Copy
http://www.wormbase.org/db/get?name=WBStrain00055261
Source Database: WormBase (WB)
Affected Genes: WBGene00010172(oac-36)
Genomic Alteration: WBGene00010172(oac-36)
Availability: unknown
Source References: EMPTY
Synonyms: oac-36(sy1411) I.
Notes: Made_by: Heenam Park & Mandy Tan|"Superficially wild-type. CRISPR/Cas9 engineered STOP-IN null mutant of oac-36. Universal 43 bp-long knock-in insertion with 3-frame stop codon (STOP-IN cassette). left flanking sequence: CTAATGTGCATGTTGCTCAAGCGTGCCGAGACCAAGC right flanking sequence: CATTTTTCACAGTGGTATGCACATTTTACACGAGG inserted sequence between the two flanking sequence (STOP-IN cassette): GGGAAGTTTGTCCAGAGCAGAGGTGACTAAGTGATAAgctagc. sgRNA: TACCACTGTGAAAAATGGCT Method Reference: G3 (Bethesda).2018 Nov 6;8(11):3607-3616"
Proper citation: RRID:WB-STRAIN:WBStrain00055261 Copy
http://www.wormbase.org/db/get?name=WBStrain00055247
Source Database: WormBase (WB)
Availability: unknown
Source References: PMID:38096407
Synonyms: syIs615.
Notes: Made_by: Jun Young Oh/Shahla Gharib|"syIs615 [15xUAS::lmp-1::Venus::let-858 3'UTR + ttx-3p::RFP + 1kb DNA ladder (NEB)]. Lysosomal associated membrane protein cGAL effector."
Proper citation: RRID:WB-STRAIN:WBStrain00055247 Copy
http://www.wormbase.org/db/get?name=WBStrain00055241
Source Database: WormBase (WB)
Availability: unknown
Source References: PMID:38096407
Synonyms: syIs589.
Notes: Made_by: Jun Young Oh/Shahla Gharib|"syIs589 [15xUAS::wrmScarlet::let-858 3'UTR + ttx-3p::RFP + 1kb DNA ladder (NEB)] mScarlet cGAL effector."
Proper citation: RRID:WB-STRAIN:WBStrain00055241 Copy
http://www.wormbase.org/db/get?name=WBStrain00055240
Source Database: WormBase (WB)
Availability: unknown
Source References: EMPTY
Synonyms: syIs534; syIs300
Notes: Made_by: Chun-Hao Chen/Jun Young Oh|"syIs534 [flp-20p::NLS::cGAL(DBD)::gp41-1-N-intein::let-858 3'UTR + inx-11p::NLS::gp41-1-C-intein::cGAL(AD)::let-858 3'UTR + unc-122p::RFP + 1kb DNA ladder (NEB)]. Split cGAL driver for gland cell. syIs300 [15xUAS::(delta)pes-10::GFP::let-858 3'UTR + ttx-3p::RFP + 1kb DNA ladder(NEB)] is a GFP cGAL effector. Some worms do not express ttx-3p::RFP marker, but will consistently produce worms with the transgenic marker in next generation."
Proper citation: RRID:WB-STRAIN:WBStrain00055240 Copy
http://www.wormbase.org/db/get?name=WBStrain00055242
Source Database: WormBase (WB)
Availability: unknown
Source References: PMID:38096407
Synonyms: syIs591; syIs300.
Notes: Made_by: Jun Young Oh/Cynthia Chen|"syIs591 [srh-142p::NLS::GAL4(sk)::VP64::let-858 3'UTR + unc-122p::RFP + 1kb DNA ladder (NEB)]. cGAL driver for ADF neuron. syIs300 [15xUAS::(delta)pes-10::GFP::let-858 3'UTR + ttx-3p::RFP + 1kb DNA ladder(NEB)] is a GFP cGAL effector. Some worms do not express ttx-3p::RFP marker, but will consistently produce worms with the transgenic marker in next generation."
Proper citation: RRID:WB-STRAIN:WBStrain00055242 Copy
http://www.wormbase.org/db/get?name=WBStrain00055249
Source Database: WormBase (WB)
Availability: unknown
Source References: EMPTY
Synonyms: syIs627; syIs300.
Notes: Made_by: Jun Young Oh/Shahla Gharib|"syIs627 [str-2p::NLS::GAL4(sk)::VP64::let-858 3'UTR + unc-122p::RFP + 1kb DNA ladder (NEB)]. cGAL driver for AWC neurons. syIs300 [15xUAS::(delta)pes-10::GFP::let-858 3'UTR + ttx-3p::RFP + 1kb DNA ladder(NEB)] is a GFP cGAL effector. Some worms do not express ttx-3p::RFP marker, but will consistently produce worms with the transgenic marker in next generation."
Proper citation: RRID:WB-STRAIN:WBStrain00055249 Copy
http://www.wormbase.org/db/get?name=WBStrain00055248
Source Database: WormBase (WB)
Affected Genes: WBGene00018728(frpr-8)
Genomic Alteration: WBGene00018728(frpr-8)
Availability: unknown
Source References: EMPTY
Synonyms: frpr-8(sy1362) X.
Notes: Made_by: Heenam Park & Mandy Tan|"Superficially wild-type. CRISPR/Cas9 engineered STOP-IN null mutant of frpr-8. Universal 43 bp-long knock-in insertion with 3-frame stop codon (STOP-IN cassette). left flanking sequence: CAGTTATTTCGCTTCTTAATAATTCTACACTGGTCA right flanking sequence: CTACGGATCAGCCAGGTTTTTCTGGAAGTACAAAAG inserted sequence between the two flanking sequence (STOP-IN cassette): GGGAAGTTTGTCCAGAGCAGAGGTGACTAAGTGATAAgctagc. sgRNA: TAATTCTACACTGGTCACTA Method Reference: G3 (Bethesda).2018 Nov 6;8(11):3607-3616"
Proper citation: RRID:WB-STRAIN:WBStrain00055248 Copy
http://www.wormbase.org/db/get?name=WBStrain00055238
Source Database: WormBase (WB)
Affected Genes: WBGene00019496(frpr-14)
Genomic Alteration: WBGene00019496(frpr-14)
Availability: unknown
Source References: EMPTY
Synonyms: frpr-14(sy1300) II.
Notes: Made_by: Heenam Park & Mandy Tan|"Superficially wild-type. CRISPR/Cas9 engineered STOP-IN null mutant of frpr-14. Universal 43 bp-long knock-in insertion with 3-frame stop codon (STOP-IN cassette). left flanking sequence: CCGATATTTTGCAATTCCTGTTTGGGATCCACAG right flanking sequence: ATCCAGAATATTTGgtgagtttaggcttaggcttag inserted sequence between the two flanking sequence (STOP-IN cassette): GGGAAGTTTGTCCAGAGCAGAGGTGACTAAGTGATAAgctagc. sgRNA: CACCAAATATTCTGGATCTG Method Reference: G3 (Bethesda).2018 Nov 6;8(11):3607-3616"
Proper citation: RRID:WB-STRAIN:WBStrain00055238 Copy
http://www.wormbase.org/db/get?name=WBStrain00055237
Source Database: WormBase (WB)
Availability: unknown
Source References: PMID:38096407
Synonyms: syIs587.
Notes: Made_by: Jun Young Oh/Shahla Gharib|"syIs587 [15xUAS::GCaMP7f::SL2::mKate::let-858 3'UTR + ttx-3p::RFP + 1kb DNA ladder (NEB)]. In vivo calcium indicator cGAL effector."
Proper citation: RRID:WB-STRAIN:WBStrain00055237 Copy
http://www.wormbase.org/db/get?name=WBStrain00055239
Source Database: WormBase (WB)
Affected Genes: WBGene00000898(daf-2)|WBGene00011083(glo-1)
Genomic Alteration: WBGene00000898(daf-2), WBGene00011083(glo-1)
Availability: unknown
Source References: EMPTY
Synonyms: daf-2 (e1370) III; glo-1(sy1306) X.
Notes: Made_by: Heenam Park|"Superficially wild-type. CRISPR/Cas9 engineered STOP-IN null mutant of glo-1 in daf-2 (e1370) background. left flanking sequence: GATAAAATTTCCTACAAAGTGTTGGTAATTGGTGA; right flanking sequence: TCCAGGTGTCGGTAAAACATCTATTATTCGTCG. Inserted sequence between the two flanking sequence (STOP-IN cassette): GGGAAGTTTGTCCAGAGCAGAGGTGACTAAGTGATAAgctagc. sgRNA: GTGTTGGTAATTGGTGATCC Method Reference: G3 (Bethesda).2018 Nov 6;8(11):3607-3616"
Proper citation: RRID:WB-STRAIN:WBStrain00055239 Copy
http://www.wormbase.org/db/get?name=WBStrain00055339
Source Database: WormBase (WB)
Availability: unknown
Source References: EMPTY
Synonyms: syIs815; syIs337.
Notes: Made_by: Mark Zhang/Stephanie Nava|"syIs815 [nlp-76p::NLS::GAL4(sk)::VP64::let-858 3'UTR + unc-122p::RFP + 1kb DNA ladder (NEB)]. cGAL driver for ASH neurons. syIs337 [15xUAS::(delta)pes-10::GFP::let-858 3'UTR + ttx-3p::RFP + 1kb DNA ladder(NEB)] is a GFP cGAL effector."
Proper citation: RRID:WB-STRAIN:WBStrain00055339 Copy
Can't find your Organism?
We recommend that you click next to the search bar to check some helpful tips on searches and refine your search firstly. If you want to find a specific organism, it's easier to enter an RRID or a Catalog Number to search. You can refine the search results using Facets on the left side of the search results page. If you are on the table view, you can also search in a specific column by clicking the column title and enter the keywords.
If you still could not find your organism in the search results, please help us by registering it into the system — it's easy. Organisms identifiers are registered through multiple sources depending on the species:
Welcome to the NIF Resources search. From here you can search through a compilation of resources used by NIF and see how data is organized within our community.
You are currently on the Community Resources tab looking through categories and sources that NIF has compiled. You can navigate through those categories from here or change to a different tab to execute your search through. Each tab gives a different perspective on data.
If you have an account on NIF then you can log in from here to get additional features in NIF such as Collections, Saved Searches, and managing Resources.
Here is the search term that is being executed, you can type in anything you want to search for. Some tips to help searching:
You can save any searches you perform for quick access to later from here.
We recognized your search term and included synonyms and inferred terms along side your term to help get the data you are looking for.
If you are logged into NIF you can add data records to your collections to create custom spreadsheets across multiple sources of data.
Here are the sources that were queried against in your search that you can investigate further.
Here are the categories present within NIF that you can filter your data on
Here are the subcategories present within this category that you can filter your data on
If you have any further questions please check out our FAQs Page to ask questions and see our tutorials. Click this button to view this tutorial again.
Welcome to the Neuroscience Information Framework Project, designed to serve the biomedical research community. NIF maintains the largest searchable collection of neuroscience data, the largest catalog of biomedical resources, and the largest ontology for neuroscience on the web. We welcome all feedback and suggestions and are actively looking for resource providers to make their resources accessible through NIF. Learn about the tools available to help you share your data and discover a dynamic inventory of Web-based neuroscience resources.
