Searching the RRID Resource Information Network
Are you sure you want to leave this community? Leaving the community will revoke any permissions you have been granted in this community.
Integrated Animals is a virtual database currently indexing available animal strains and mutants from: AGSC (Ambystoma), BCBC (mice), BDSC (flies), European Xenopus Resource Center (frog), The National Xenopus Resource (frog), Xenopus Express (frog), CWRU Cystic Fibrosis Mouse Models (mice), DGGR (flies), FlyBase (flies), IMSR (mice), MGI (mice), MMRRC (mice), NSRRC (pig), RGD (rats), Sperm Stem Cell Libraries for Biological Research (rats), Tetrahymena Stock Center (Tetrahymena), WormBase (worms), XGSC (Xiphophorus), ZFIN (zebrafish), and ZIRC (zebrafish). Note, the IMSR data is linked, but users may need to re-execute the search if the top mouse is not returned properly.
Note: BCBC is no longer in service, so the links may not be functional.
| Organism Name | Proper Citation | Species | Synonyms |
Notes |
Phenotype | Affected Gene | ||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
|
col-73(sy1792) II. Resource Report Resource Website |
RRID:WB-STRAIN:WBStrain00055324 | Caenorhabditis elegans | col-73(sy1792) II. | Made_by: Heenam Park|"Superficially wild-type. CRISPR/Cas9 engineered STOP-IN null mutant of col-73. Universal 43 bp-long knock-in insertion with 3-frame stop codon (STOP-IN cassette). left flanking sequence: GACCAGATGCTCCAAATGAGCACGTTCAACCAACT right flanking sequence: CCAGCCGATTTCTGCTTCGAGTGCCCACCAGGACC inserted sequence between the two flanking sequence (STOP-IN cassette): GGGAAGTTTGTCCAGAGCAGAGGTGACTAAGTGATAAgctagc. sgRNA: AAGCAGAAATCGGCTGGAGT Method Reference: G3 (Bethesda).2018 Nov 6;8(11):3607-3616" | WBGene00000649(col-73) | WBGene00000649(col-73) | WB-STRAIN:WBStrain00055324 | WormBase (WB) | WB | unknown | 2026-08-29 09:28:53 | 0 | ||||
|
flp-22(sy1608) I. Resource Report Resource Website |
RRID:WB-STRAIN:WBStrain00055285 | Caenorhabditis elegans | flp-22(sy1608) I. | Made_by: Heenam Park|"Superficially wild-type. CRISPR/Cas9 engineered STOP-IN null mutant of flp-22. Universal 43 bp-long knock-in insertion with 3-frame stop codon (STOP-IN cassette). left flanking sequence: CCTTTGTGTTGTTTTGATGGTATCATTGGTGTCGG right flanking sequence: CTCAGGTCTTCGATTTGGATGGACAACAGTTGGC inserted sequence between the two flanking sequence (STOP-IN cassette): GGGAAGTTTGTCCAGAGCAGAGGTGACTAAGTGATAAgctagc. sgRNA: GGTATCATTGGTGTCGGCTC Method Reference: G3 (Bethesda).2018 Nov 6;8(11):3607-3616" | WBGene00009562(flp-22) | WBGene00009562(flp-22) | WB-STRAIN:WBStrain00055285 | WormBase (WB) | WB | unknown | 2026-08-29 09:28:53 | 0 | ||||
|
syIs612. Resource Report Resource Website |
RRID:WB-STRAIN:WBStrain00055284 | Caenorhabditis elegans | syIs612. | Made_by: Jun Young Oh/Mark Zhang|"syIs612 [15xUAS::GCaMP7b::SL2::mKate::let-858 3'UTR + ttx-3p::RFP + 1kb DNA ladder (NEB)]. In vivo calcium indicator cGAL effector." | WB-STRAIN:WBStrain00055284 | WormBase (WB) | WB | unknown | 2026-08-29 09:28:52 | 0 | ||||||
|
him-5(e1490) V; str-74(sy1802) X. Resource Report Resource Website |
RRID:WB-STRAIN:WBStrain00055329 | Caenorhabditis elegans | him-5(e1490) V; str-74(sy1802) X. | Made_by: Heenam Park|"Superficially wild-type. CRISPR/Cas9 engineered STOP-IN null mutant of str-74 in him-5(e1490) background. Universal 43 bp-long knock-in insertion with 3-frame stop codon (STOP-IN cassette). left flanking sequence: GGGAATATTGTTTTCGGGAATAGAAATCCTTGC right flanking sequence: CAGACCATTCGCTCATAATTATAACAACAGTTTGATG inserted sequence between the two flanking sequence (STOP-IN cassette): GGGAAGTTTGTCCAGAGCAGAGGTGACTAAGTGATAAgctagc. sgRNA: TATGAGCGAATGGTCTGGCA Method Reference: G3 (Bethesda). 2018 Nov 6;8(11):3607-3616" | WBGene00001864(him-5)|WBGene00006135(str-74) | WBGene00001864(him-5), WBGene00006135(str-74) | WB-STRAIN:WBStrain00055329 | WormBase (WB) | WB | unknown | 2026-08-29 09:28:53 | 0 | ||||
|
ufd-3(sy1796) II. Resource Report Resource Website |
RRID:WB-STRAIN:WBStrain00055326 | Caenorhabditis elegans | ufd-3(sy1796) II. | Made_by: Heenam Park|"Superficially wild type. CRISPR/Cas9 engineered STOP-IN null mutant of ufd-3. Universal 43bp-long knock-in insertion with 3-frame stop codon (STOP-IN cassette) into the 1st one of the exons shared by all isoforms of the gene. Left flanking sequence: CTCATCATTCACTGAATTCGTATTTCTGTGATCGTGA. Right flanking sequence: ACGTGGTCAGGAACTTGTCGGAAGATTAATTGC. Inserted sequence between the two-flanking sequence (STOP-IN cassette): GGGAAGTTTGTCCAGAGCAGAGGTGACTAAGTGATAAgctagc. sgRNA: TATTTCTGTGATCGTGAACG Method Reference: Wang H, et al. G3 (Bethesda).2018 Nov 6;8(11):3607-3616." | WBGene00007333(ufd-3) | WBGene00007333(ufd-3) | WB-STRAIN:WBStrain00055326 | WormBase (WB) | WB | unknown | 2026-08-29 09:28:53 | 0 | ||||
|
col-54(sy1630) I. Resource Report Resource Website |
RRID:WB-STRAIN:WBStrain00055291 | Caenorhabditis elegans | col-54(sy1630) I. | Made_by: Heenam Park|"Superficially wild-type. CRISPR/Cas9 engineered STOP-IN null mutant of col-54. Universal 43 bp-long knock-in insertion with 3-frame stop codon (STOP-IN cassette). left flanking sequence: CAGTCTTCTTGTTGCTGGATCATTATTCTTTGAAGC right flanking sequence: TCAAGGATTTTTAGAGACTTCACTTGATGAAATTG inserted sequence between the two flanking sequence (STOP-IN cassette): GGGAAGTTTGTCCAGAGCAGAGGTGACTAAGTGATAAgctagc. sgRNA: TCATTATTCTTTGAAGCTCA Method Reference: G3 (Bethesda).2018 Nov 6;8(11):3607-3616" | WBGene00000631(col-54) | WBGene00000631(col-54) | WB-STRAIN:WBStrain00055291 | WormBase (WB) | WB | unknown | 2026-08-29 09:28:53 | 0 | ||||
|
syIs748; syIs300. Resource Report Resource Website |
RRID:WB-STRAIN:WBStrain00055293 | Caenorhabditis elegans | syIs748; syIs300. | Made_by: Stephanie Nava/Shahla Gharib|"syIs748 [tbh-1p::NLS::GAL4(sk)::VP64::let-858 3'UTR + unc-122p::RFP + 1kb DNA ladder (NEB)] cGAL driver for RIC neurons. syIs300 [15xUAS::(delta)pes-10::GFP::let-858 3'UTR + ttx-3p::RFP + 1kb DNA ladder(NEB)] is a GFP cGAL effector. Some worms do not express ttx-3p::RFP marker, but will consistently produce worms with the transgenic marker in next generation." | WB-STRAIN:WBStrain00055293 | WormBase (WB) | WB | unknown | 2026-08-29 09:28:53 | 0 | ||||||
|
col-40(sy1628) II. Resource Report Resource Website |
RRID:WB-STRAIN:WBStrain00055290 | Caenorhabditis elegans | col-40(sy1628) II. | Made_by: Heenam Park|"Superficially wild-type. CRISPR/Cas9 engineered STOP-IN null mutant of col-40. Universal 43 bp-long knock-in insertion with 3-frame stop codon (STOP-IN cassette). left flanking sequence: aactattttcagGTCGAATTCTGCAAGCACCGAAC right flanking sequence: TGACGGACTCTGGGATGAGTTCCACAGAgtaagta inserted sequence between the two flanking sequence (STOP-IN cassette): GGGAAGTTTGTCCAGAGCAGAGGTGACTAAGTGATAAgctagc. sgRNA: TTCTGCAAGCACCGAACTGA Method Reference: G3 (Bethesda).2018 Nov 6;8(11):3607-3616" | WBGene00000617(col-40) | WBGene00000617(col-40) | WB-STRAIN:WBStrain00055290 | WormBase (WB) | WB | unknown | 2026-08-29 09:28:53 | 0 | ||||
|
syIs716; syIs300. Resource Report Resource Website |
RRID:WB-STRAIN:WBStrain00055278 | Caenorhabditis elegans | syIs716; syIs300. | Made_by: Mark Zhang/Stephanie Nava|"syIs716 [klp-6p::NLS::GAL4(sk)::VP64::let-858 3'UTR + unc-122p::RFP + 1kb DNA ladder (NEB)]. cGAL driver for IL2 neurons. syIs300 [15xUAS::(delta)pes-10::GFP::let-858 3'UTR + ttx-3p::RFP + 1kb DNA ladder(NEB)] is a GFP cGAL effector. Some worms do not express ttx-3p::RFP marker, but will consistently produce worms with the transgenic marker in next generation." | WB-STRAIN:WBStrain00055278 | WormBase (WB) | WB | unknown | 2026-08-29 09:28:52 | 0 | ||||||
|
syIs788. Resource Report Resource Website |
RRID:WB-STRAIN:WBStrain00055311 | Caenorhabditis elegans | syIs788. | Made_by: Mark Zhang/Stephanie Nava|"syIs788 [srt-28p::NLS::GAL4(sk)::VP64::let-858 3'UTR + unc-122p::RFP + 1kb DNA ladder (NEB)]. cGAL driver for AWC-OFF neuron." | WB-STRAIN:WBStrain00055311 | WormBase (WB) | WB | unknown | 2026-08-29 09:28:53 | 0 | ||||||
|
syIs710; syIs300. Resource Report Resource Website |
RRID:WB-STRAIN:WBStrain00055277 | Caenorhabditis elegans | syIs710; syIs300. | Made_by: Stephanie Nava/Shahla Gharib|"syIs710 [srg-13p::NLS::GAL4(sk)::VP64::let-858 3'UTR + unc-122p::RFP + 1kb DNA ladder (NEB)]. cGAL driver for PHA neurons. syIs300 [15xUAS::(delta)pes-10::GFP::let-858 3'UTR + ttx-3p::RFP + 1kb DNA ladder(NEB)] is a GFP cGAL effector. Some worms do not express ttx-3p::RFP marker, but will consistently produce worms with the transgenic marker in next generation." | WB-STRAIN:WBStrain00055277 | WormBase (WB) | WB | unknown | 2026-08-29 09:28:53 | 0 | ||||||
|
oac-21(sy1566) IV. Resource Report Resource Website |
RRID:WB-STRAIN:WBStrain00055279 | Caenorhabditis elegans | oac-21(sy1566) IV. | Made_by: Heenam Park/Wilber Palma|"Superficially wild-type. CRISPR/Cas9 engineered STOP-IN null mutant of oac-21. Universal 43 bp-long knock-in insertion with 3-frame stop codon (STOP-IN cassette). left flanking sequence: CACAAAAATCTTCAAAACGACTAGATCTTCAAGGC right flanking sequence: ATCCGGGCTCTCGCTATTCTAGTTGTTCTTGGCTTTC inserted sequence between the two flanking sequence (STOP-IN cassette): GGGAAGTTTGTCCAGAGCAGAGGTGACTAAGTGATAAgctagc. sgRNA: GACTAGATCTTCAAGGCATC Method Reference: G3 (Bethesda).2018 Nov 6;8(11):3607-3616" | WBGene00018141(oac-21) | WBGene00018141(oac-21) | WB-STRAIN:WBStrain00055279 | WormBase (WB) | WB | unknown | 2026-08-29 09:28:52 | 0 | ||||
|
syIs794; syIs337. Resource Report Resource Website |
RRID:WB-STRAIN:WBStrain00055312 | Caenorhabditis elegans | syIs794; syIs337. | Made_by: Mark Zhang/Stephanie Nava|"syIs794 [F47D2.11::NLS::GAL4(sk)::VP64::let-858 3'UTR + unc-122p::RFP + 1kb DNA ladder (NEB)]. cGAL driver for ASJ neurons. syIs337 [15xUAS::(delta)pes-10::GFP::let-858 3'UTR + ttx-3p::RFP + 1kb DNA ladder(NEB)] is a GFP cGAL effector." | WB-STRAIN:WBStrain00055312 | WormBase (WB) | WB | unknown | 2026-08-29 09:28:53 | 0 | ||||||
|
syIs704; syIs300. Resource Report Resource Website |
RRID:WB-STRAIN:WBStrain00055274 | Caenorhabditis elegans | syIs704; syIs300. | Made_by: Stephanie Nava/Shahla Gharib|"syIs704 [pdf-1p::NLS::cGAL(DBD)::gp41-1-N-intein::let-858 3'UTR + mbr-1p::NLS::gp41-1-C-intein::cGAL(AD)::let-858 3'UTR + unc-122p::RFP + 1kb DNA ladder (NEB)]. Split cGAL driver for AIM neurons. syIs300 [15xUAS::(delta)pes-10::GFP::let-858 3'UTR + ttx-3p::RFP + 1kb DNA ladder(NEB)] is a GFP cGAL effector. Some worms do not express ttx-3p::RFP marker, but will consistently produce worms with the transgenic marker in next generation." | WB-STRAIN:WBStrain00055274 | WormBase (WB) | WB | unknown | 2026-08-29 09:28:53 | 0 | ||||||
|
syIs707; syIs300. Resource Report Resource Website |
RRID:WB-STRAIN:WBStrain00055276 | Caenorhabditis elegans | syIs707; syIs300. | Made_by: Stephanie Nava/Shahla Gharib|"syIs707 [osm-10p::NLS::cGAL(DBD)::gp41-1-N-intein::let-858 3'UTR, srb-6p::NLS::gp41-1-C-intein::cGAL(AD)::let-858 3'UTR + unc-122p::RFP + 1kb DNA ladder (NEB)] split cGAL driver for PHA and PHB neurons. syIs300 [15xUAS::(delta)pes-10::GFP::let-858 3'UTR + ttx-3p::RFP + 1kb DNA ladder(NEB)] is a GFP cGAL effector. Some worms do not express ttx-3p::RFP marker, but will consistently produce worms with the transgenic marker in next generation." | WB-STRAIN:WBStrain00055276 | WormBase (WB) | WB | unknown | 2026-08-29 09:28:52 | 0 | ||||||
|
syIs705; syIs300. Resource Report Resource Website |
RRID:WB-STRAIN:WBStrain00055275 | Caenorhabditis elegans | syIs705; syIs300. | Made_by: Stephanie Nava/Shahla Gharib|"syIs705 [gcy-32p::NLS::GAL4(sk)::VP64::let-858 3'UTR + unc-122p::RFP + 1kb DNA ladder (NEB)]. cGAL driver for AQR, PQR, and URX neurons. syIs300 [15xUAS::(delta)pes-10::GFP::let-858 3'UTR + ttx-3p::RFP + 1kb DNA ladder(NEB)] is a GFP cGAL effector. Some worms do not express ttx-3p::RFP marker, but will consistently produce worms with the transgenic marker in next generation." | WB-STRAIN:WBStrain00055275 | WormBase (WB) | WB | unknown | PMID:38096407 | 2026-08-29 09:28:52 | 0 | |||||
|
syIs798. Resource Report Resource Website |
RRID:WB-STRAIN:WBStrain00055314 | Caenorhabditis elegans | syIs798. | Made_by: Mark Zhang/Stephanie Nava|"syIs798 [srt-47p::NLS::GAL4(sk)::VP64::let-858 3'UTR + unc-122p::RFP + 1kb DNA ladder (NEB)]. cGAL driver for AWC-ON neuron." | WB-STRAIN:WBStrain00055314 | WormBase (WB) | WB | unknown | 2026-08-29 09:28:53 | 0 | ||||||
|
syIs743; syIs300. Resource Report Resource Website |
RRID:WB-STRAIN:WBStrain00055281 | Caenorhabditis elegans | syIs743; syIs300. | Made_by: Stephanie Nava/Shahla Gharib|"syIs743 [pks-1p::NLS::GAL4(sk)::VP64::let-858 3'UTR + unc-122p::RFP + 1kb DNA ladder (NEB)] cGAL driver for CAN neurons. syIs300 [15xUAS::(delta)pes-10::GFP::let-858 3'UTR + ttx-3p::RFP + 1kb DNA ladder(NEB)] is a GFP cGAL effector. Some worms do not express ttx-3p::RFP marker, but will consistently produce worms with the transgenic marker in next generation." | WB-STRAIN:WBStrain00055281 | WormBase (WB) | WB | unknown | 2026-08-29 09:28:52 | 0 | ||||||
|
syIs680; syIs300. Resource Report Resource Website |
RRID:WB-STRAIN:WBStrain00055266 | Caenorhabditis elegans | syIs680; syIs300. | Made_by: Stephanie Nava/Shahla Gharib|"syIs680 [gcy-5p::NLS::GAL4(sk)::VP64::let-858 3'UTR + unc-122p::RFP + 1kb DNA ladder (NEB)]. cGAL driver for ASEL neuron. syIs300 [15xUAS::(delta)pes-10::GFP::let-858 3'UTR + ttx-3p::RFP + 1kb DNA ladder(NEB)] is a GFP cGAL effector. Some worms do not express ttx-3p::RFP marker, but will consistently produce worms with the transgenic marker in next generation." | WB-STRAIN:WBStrain00055266 | WormBase (WB) | WB | unknown | PMID:38096407 | 2026-08-29 09:28:52 | 0 | |||||
|
srx-12(sy1746) IV. Resource Report Resource Website |
RRID:WB-STRAIN:WBStrain00055302 | Caenorhabditis elegans | srx-12(sy1746) IV. | Made_by: Heenam Park|"Superficially wild-type. CRISPR/Cas9 engineered STOP-IN null mutant of srx-12. Universal 43 bp-long knock-in insertion with 3-frame stop codon (STOP-IN cassette). left flanking sequence: CCATTGCAAATTTTGGGGTTCTATTTGTATTCTGC right flanking sequence: ACATGGGTCACGCCGACCACTATTATgtaggtttttg inserted sequence between the two flanking sequence (STOP-IN cassette): GGGAAGTTTGTCCAGAGCAGAGGTGACTAAGTGATAAgctagc. sgRNA: TTCTATTTGTATTCTGCACA Method Reference: G3 (Bethesda).2018 Nov 6;8(11):3607-3616" | WBGene00005903(srx-12) | WBGene00005903(srx-12) | WB-STRAIN:WBStrain00055302 | WormBase (WB) | WB | unknown | 2026-08-29 09:28:53 | 0 |
Can't find your Organism?
We recommend that you click next to the search bar to check some helpful tips on searches and refine your search firstly. If you want to find a specific organism, it's easier to enter an RRID or a Catalog Number to search. You can refine the search results using Facets on the left side of the search results page. If you are on the table view, you can also search in a specific column by clicking the column title and enter the keywords.
If you still could not find your organism in the search results, please help us by registering it into the system — it's easy. Organisms identifiers are registered through multiple sources depending on the species:
Welcome to the NIF Resources search. From here you can search through a compilation of resources used by NIF and see how data is organized within our community.
You are currently on the Community Resources tab looking through categories and sources that NIF has compiled. You can navigate through those categories from here or change to a different tab to execute your search through. Each tab gives a different perspective on data.
If you have an account on NIF then you can log in from here to get additional features in NIF such as Collections, Saved Searches, and managing Resources.
Here is the search term that is being executed, you can type in anything you want to search for. Some tips to help searching:
If you are logged into NIF you can add data records to your collections to create custom spreadsheets across multiple sources of data.
Here are the facets that you can filter the data by.
If you have any further questions please check out our FAQs Page to ask questions and see our tutorials. Click this button to view this tutorial again.
Welcome to the Neuroscience Information Framework Project, designed to serve the biomedical research community. NIF maintains the largest searchable collection of neuroscience data, the largest catalog of biomedical resources, and the largest ontology for neuroscience on the web. We welcome all feedback and suggestions and are actively looking for resource providers to make their resources accessible through NIF. Learn about the tools available to help you share your data and discover a dynamic inventory of Web-based neuroscience resources.
