Searching the RRID Resource Information Network
Are you sure you want to leave this community? Leaving the community will revoke any permissions you have been granted in this community.
Integrated Animals is a virtual database currently indexing available animal strains and mutants from: AGSC (Ambystoma), BCBC (mice), BDSC (flies), European Xenopus Resource Center (frog), The National Xenopus Resource (frog), Xenopus Express (frog), CWRU Cystic Fibrosis Mouse Models (mice), DGGR (flies), FlyBase (flies), IMSR (mice), MGI (mice), MMRRC (mice), NSRRC (pig), RGD (rats), Sperm Stem Cell Libraries for Biological Research (rats), Tetrahymena Stock Center (Tetrahymena), WormBase (worms), XGSC (Xiphophorus), ZFIN (zebrafish), and ZIRC (zebrafish). Note, the IMSR data is linked, but users may need to re-execute the search if the top mouse is not returned properly.
Note: BCBC is no longer in service, so the links may not be functional.
http://www.wormbase.org/db/get?name=WBStrain00003813
Source Database: WormBase (WB)
Affected Genes: WBGene00004743(scm-1)|WBGene00004912(sng-1)|WBGene00004979(sph-1)
Genomic Alteration: WBGene00004743(scm-1), WBGene00004912(sng-1), WBGene00004979(sph-1)
Availability: available
Source References: EMPTY
Synonyms: scm-1(hd30) I; sph-1(ox278) IV; sng-1(ok234) X.
Alternate IDs: WB-STRAIN:BJ21, CGC_BJ21
Notes: EMPTY
Proper citation: RRID:WB-STRAIN:WBStrain00003813 Copy
http://www.wormbase.org/db/get?name=WBStrain00003897
Source Database: WormBase (WB)
Affected Genes: WBGene00000500(chn-1)
Genomic Alteration: WBGene00000500(chn-1)
Availability: available
Source References: PMID:39384041
Synonyms: chn-1(by155) I.
Alternate IDs: WB-STRAIN:BR2823, CGC_BR2823
Notes: 989bp deletion. Primers used: RB1537 (external left): CAAGCTTAATTTGCACACAATGCGTCAG; RB1540 (external right): AGAAGAGGCAAGAATGGAACTTGTGCG; RB1538 (internal left): AACAATTTCCGCTTATTTTCAGCGTTTG; RB1539 (internal right): CTGAACCATTGAAAGCTTTTCAGATC. Deletion breakpoints (T09B4 coordinates): 32756/33746 through 32757/33747.|"Made_by: Hoppe/Sperl"
Proper citation: RRID:WB-STRAIN:WBStrain00003897 Copy
http://www.wormbase.org/db/get?name=WBStrain00003894
Source Database: WormBase (WB)
Affected Genes: WBGene00003877(pept-1)
Genomic Alteration: WBGene00003877(pept-1)
Availability: available
Source References: PMID:33157031, PMID:38991033, PMID:39284915
Synonyms: pept-1(lg601) X.
Alternate IDs: WB-STRAIN:BR2742, CGC_BR2742
Notes: Made_by: Elegene|"Mutagen:UV/TMP"|"Slow postembryonic development. Reduced brood size. Previously known as pep-2. [NOTE: the genotype of this strain was previously incorrectly annotated as lg1601. The correct allele name is lg601.] Reference: Meissner B, et al. J Biol Chem. 2004 Aug 27;279(35):36739-45."|"WBStrain mapped, WBPaper00060602 added based on AFP_Strain data."
Proper citation: RRID:WB-STRAIN:WBStrain00003894 Copy
http://www.wormbase.org/db/get?name=WBStrain00003829
Source Database: WormBase (WB)
Affected Genes: WBGene00001867(him-8)
Genomic Alteration: WBGene00001867(him-8)
Availability: available
Source References: PMID:34534446
Synonyms: inIs179 [ida-1p::GFP] II; him-8(e1489) IV
Alternate IDs: WB-STRAIN:BL5717, CGC_BL5717
Notes: inIs179 [ida-1p::GFP]. GFP is expressed in a subset of neurons and the neuroendocrine uv1 cells of the vulva. Identified neurons include ADE, ALA, ASI, ASK, AUA, ASG, AVH, AVJ, AVK, VC, HSN, PDE, PVP, PHA, PHB, PHC. Male sex-specific neurons include CA and some ray neurons. Plasmid pida-1::GFP 7.6 was injected into N2 and integrated to generate BL5715, then crossed into him-8(e1489) background.|"Made_by: T Zahn/P MacMorris"|"Mutagen:Gamma rays"
Proper citation: RRID:WB-STRAIN:WBStrain00003829 Copy
http://www.wormbase.org/db/get?name=WBStrain00003902
Source Database: WormBase (WB)
Availability: available
Source References: PMID:37549461, PMID:39149885
Synonyms: byIs162.
Alternate IDs: WB-STRAIN:BR5271, CGC_BR5271
Notes: byIs162 [rab-3p::F3(delta)K280 I277P I380P + myo-2p::mCherry]. Pan-neuronal over-expression of the F3 pro aggregation fragment of the human Tau protein with K280 deleted and two isoleucines to proline substitutions in the hexapeptide motifs of the repeat region (line A). These mutations abrogate the aggregation, making this strain an anti-aggregation control for BR5270. Reference: Fatuouros C, et al. Hum Mol Genet. 2012 Aug 15;21(16):3587-603.|"byIs162 [rab-3p::F3(delta)K280 I277P I380P + myo-2p::mCherry]. Pan-neuronal overexpression of the F3 pro aggregation fragment of the human Tau protein with K280 deleted and two isoleucines to proline substitutions in the hexapeptide motifs of the repeat region (line A). These mutations abrogate the aggregation, making this strain an anti-aggregation control for BR5270. Reference: Fatuouros C, et al. Hum Mol Genet. 2012 Aug 15;21(16):3587-603."|"Made_by: C. Fatouros"|"Mutagen:Gamma radiation"
Proper citation: RRID:WB-STRAIN:WBStrain00003902 Copy
http://www.wormbase.org/db/get?name=WBStrain00003936
Source Database: WormBase (WB)
Affected Genes: WBGene00001609(glp-1)|WBGene00006768(unc-32)|WBGene00006772(unc-36)
Genomic Alteration: WBGene00001609(glp-1), WBGene00006768(unc-32), WBGene00006772(unc-36)
Availability: available
Source References: PMID:9043073
Synonyms: unc-32(e189) glp-1(oz112)/unc-36(e251) glp-1(q175) III.
Alternate IDs: WB-STRAIN:BS913, CGC_BS913
Notes: Heterozygotes are WT and segregate WT and Uncs (both Unc-32 and Unc-36). Tumorous germline phenotype in both hermaphrodites and males; semidominant and temperature sensitive. Even at permissive temperatures (15-20C) brood size is very small (10-20 viable progeny) because of the overproliferation of germ cells at the expense of oogenesis.|"No longer available from the CGC catalogue 24/04/2020"
Proper citation: RRID:WB-STRAIN:WBStrain00003936 Copy
http://www.wormbase.org/db/get?name=WBStrain00003934
Source Database: WormBase (WB)
Affected Genes: WBGene00001482(fog-2)
Genomic Alteration: WBGene00001482(fog-2)
Availability: available
Source References: PMID:32338603, PMID:38967024
Synonyms: fog-2(oz40) V.
Alternate IDs: WB-STRAIN:BS553, CGC_BS553
Notes: Male/female strain. Maintain by mating.|"Mutagen: Psoralen"|"WBStrain mapped, WBPaper00059605 added based on AFP_Strain data."
Proper citation: RRID:WB-STRAIN:WBStrain00003934 Copy
http://www.wormbase.org/db/get?name=WBStrain00004001
Source Database: WormBase (WB)
Affected Genes: WBGene00000936(dbl-1)
Genomic Alteration: WBGene00000936(dbl-1)
Availability: available
Source References: EMPTY
Synonyms: ctIs40 X.
Alternate IDs: WB-STRAIN:BW1940, CGC_BW1940
Notes: ctIs40 [dbl-1(+) + sur-5::GFP]. Lon. dbl-1 over-expressing line from injection of constructs ZC421 and pTG98.
Proper citation: RRID:WB-STRAIN:WBStrain00004001 Copy
http://www.wormbase.org/db/get?name=WBStrain00003942
Source Database: WormBase (WB)
Affected Genes: WBGene00004057(pmk-3)
Genomic Alteration: WBGene00004057(pmk-3)
Availability: available
Source References: PMID:37310929, PMID:39532199
Synonyms: pmk-3(ok169).
Alternate IDs: WB-STRAIN:BS3383, CGC_BS3383
Notes: F42G8.4. No obvious phenotype. Follow by PCR. Predicted gene is a p38 related Map Kinase. Approx. 1.5 kb deletion by agarose gel (not sequenced so end points not known). Nested PCR primers for detecting F42G8.4: F42G8.4EL1 5' - TCGCCCTTTGTATGTCTTCC - 3'. F42G8.4ER1 5' - TTCTCCAGGGATTAACGGTG - 3'. F42G8.4IL1 5' - TTTTCACTGCGTCTCAATCG - 3'. F42G8.4IR1 5' - TTTCAAATTTGCAGGTGTGC - 3'.|"Made_by: Barstead/Moulder"
Proper citation: RRID:WB-STRAIN:WBStrain00003942 Copy
http://www.wormbase.org/db/get?name=WBStrain00003952
Source Database: WormBase (WB)
Affected Genes: WBGene00001863(him-4)
Genomic Alteration: WBGene00001863(him-4)
Availability: available
Source References: PMID:38177158
Synonyms: him-4(rh319) X.
Alternate IDs: WB-STRAIN:BT12, CGC_BT12
Notes: Him. Reference: Vogel BE, Hedgecock EM. (2001) Development. 128:883-94.
Proper citation: RRID:WB-STRAIN:WBStrain00003952 Copy
http://www.wormbase.org/db/get?name=WBStrain00004020
Source Database: WormBase (WB)
Affected Genes: WBGene00001399(fat-7)
Genomic Alteration: WBGene00001399(fat-7)
Availability: available
Source References: PMID:33009389, PMID:36653384, PMID:37541249
Synonyms: fat-7(wa36) V.
Alternate IDs: WB-STRAIN:BX153, CGC_BX153
Notes: Made_by:|"Supplementary_genotype fat-7(wa36)"
Proper citation: RRID:WB-STRAIN:WBStrain00004020 Copy
http://www.wormbase.org/db/get?name=WBStrain00004018
Source Database: WormBase (WB)
Affected Genes: WBGene00023497(lin-15B)|WBGene00023498(lin-15A)
Genomic Alteration: WBGene00023497(lin-15B), WBGene00023498(lin-15A)
Availability: available
Source References: PMID:38374083
Synonyms: lin-15B&lin-15A(n765) X; waEx16.
Alternate IDs: WB-STRAIN:BX115, CGC_BX115
Notes: waEx16 [fat-6::GFP + lin15(+)]. Maintain by picking non-Muv animals. These should be GFP+.
Proper citation: RRID:WB-STRAIN:WBStrain00004018 Copy
http://www.wormbase.org/db/get?name=WBStrain00004015
Source Database: WormBase (WB)
Affected Genes: WBGene00001397(fat-5)
Genomic Alteration: WBGene00001397(fat-5)
Availability: available
Source References: PMID:32302543, PMID:36653384, PMID:37541249
Synonyms: fat-5(tm420) V.
Alternate IDs: WB-STRAIN:BX107, CGC_BX107
Notes: Mutagen:UV/TMP|"Received new stock with confirmed deletion from Jennifer Watts 07/16/2009."|"Supplementary_genotype fat-5(tm420)"|"WBStrain mapped, WBPaper00059578 added based on AFP_Strain data."
Proper citation: RRID:WB-STRAIN:WBStrain00004015 Copy
http://www.wormbase.org/db/get?name=WBStrain00004013
Source Database: WormBase (WB)
Affected Genes: WBGene00001393(fat-1)|WBGene00001396(fat-4)
Genomic Alteration: WBGene00001393(fat-1), WBGene00001396(fat-4)
Availability: available
Source References: PMID:37541249
Synonyms: fat-4(wa14) fat-1(wa9) IV.
Alternate IDs: WB-STRAIN:BX52, CGC_BX52
Notes: Made_by:|"Supplementary_genotype fat-4(wa14) fat-1(wa9)"
Proper citation: RRID:WB-STRAIN:WBStrain00004013 Copy
http://www.wormbase.org/db/get?name=WBStrain00004014
Source Database: WormBase (WB)
Affected Genes: WBGene00001398(fat-6)
Genomic Alteration: WBGene00001398(fat-6)
Availability: available
Source References: PMID:36653384
Synonyms: fat-6(tm331) IV.
Alternate IDs: WB-STRAIN:BX106, CGC_BX106
Notes: Mutagen:UV/TP|"Received new stock with confirmed deletion from Jennifer Watts 07/16/2009."
Proper citation: RRID:WB-STRAIN:WBStrain00004014 Copy
http://www.wormbase.org/db/get?name=WBStrain00004044
Source Database: WormBase (WB)
Affected Genes: WBGene00001867(him-8)
Genomic Alteration: WBGene00001867(him-8)
Availability: available
Source References: PMID:33575816, PMID:33740426, PMID:37078421
Synonyms: him-8(tm611) IV.
Alternate IDs: WB-STRAIN:CA257, CGC_CA257
Notes: 37% XO self progeny. Recessive.|"WBStrain mapped, WBPaper00061039 added based on AFP_Strain data."|"WBStrain mapped, WBPaper00061201 added based on AFP_Strain data."
Proper citation: RRID:WB-STRAIN:WBStrain00004044 Copy
http://www.wormbase.org/db/get?name=WBStrain00004045
Source Database: WormBase (WB)
Affected Genes: WBGene00011600(zim-2)
Genomic Alteration: WBGene00011600(zim-2)
Availability: available
Source References: PMID:33377003, PMID:34081106
Synonyms: zim-2(tm574) IV.
Alternate IDs: WB-STRAIN:CA258, CGC_CA258
Notes: Mutagen:UV/TMP|"WBStrain mapped, WBPaper00060819 added based on AFP_Strain data."|"WBStrain mapped, WBPaper00061461 added based on AFP_Strain data."|"Weak Him. Produces unhatched eggs."
Proper citation: RRID:WB-STRAIN:WBStrain00004045 Copy
http://www.wormbase.org/db/get?name=WBStrain00004042
Source Database: WormBase (WB)
Affected Genes: WBGene00007664(seb-3)
Genomic Alteration: WBGene00007664(seb-3)
Availability: available
Source References: EMPTY
Synonyms: seb-3(eg696) X.
Alternate IDs: WB-STRAIN:BZ1202, CGC_BZ1202
Notes: This strain is tolerant to acute treatment of ethanol. The severity and incidence of stress-induced tremors are greater than in wild-type. Reference: Jee C, et al. Genes Brain Behav. 2013 Mar;12(2):250-62.
Proper citation: RRID:WB-STRAIN:WBStrain00004042 Copy
http://www.wormbase.org/db/get?name=WBStrain00004038
Source Database: WormBase (WB)
Affected Genes: WBGene00004830(slo-1)
Genomic Alteration: WBGene00004830(slo-1)
Availability: available
Source References: PMID:33524034
Synonyms: slo-1(eg142) V.
Alternate IDs: WB-STRAIN:BZ142, CGC_BZ142
Notes: Head-bending phenotype. Maintain under normal conditions. Reference: Kim, H et al. (2009) PLoS Genetics 5(12):31000780.|"Made_by: Hoky Kim"|"WBStrain mapped, WBPaper00060969 added based on AFP_Strain data."
Proper citation: RRID:WB-STRAIN:WBStrain00004038 Copy
http://www.wormbase.org/db/get?name=WBStrain00004055
Source Database: WormBase (WB)
Affected Genes: WBGene00006843(unc-119)
Genomic Alteration: WBGene00006843(unc-119)
Availability: available
Source References: PMID:32550513, PMID:32550493, PMID:33300872, PMID:34505574, PMID:34663906, PMID:34865044, PMID:37507441, PMID:38282418, PMID:38878287
Synonyms: ieSi57 [eft-3p::TIR1::mRuby::unc-54 3'UTR + Cbr-unc-119(+)] II.
Alternate IDs: WB-STRAIN:CA1200, CGC_CA1200
Notes: ieSi57 [eft-3p::TIR1::mRuby::unc-54 3'UTR + Cbr-unc-119(+)] II. Single copy transgene inserted into chromosome II (oxTi179) expressing modified Arabidopsis thaliana TIR1 tagged with mRuby in the soma. This strain can be used for auxin-inducible degradation (AID) in somatic tissues. Reference: Zhang L, et al. Development. 2015 Nov 9. pii: dev.129635.|"WBStrain provided so WBPaper00060223 paper added based on AFP_Strain data."|"WBStrain provided so WBPaper00060754 paper added based on AFP_Strain data."|"WBStrain provided so WBPaper00061869 paper added based on AFP_Strain data."|"WBStrain provided so WBPaper00062146 paper added based on AFP_Strain data."
Proper citation: RRID:WB-STRAIN:WBStrain00004055 Copy
Can't find your Organism?
We recommend that you click next to the search bar to check some helpful tips on searches and refine your search firstly. If you want to find a specific organism, it's easier to enter an RRID or a Catalog Number to search. You can refine the search results using Facets on the left side of the search results page. If you are on the table view, you can also search in a specific column by clicking the column title and enter the keywords.
If you still could not find your organism in the search results, please help us by registering it into the system — it's easy. Organisms identifiers are registered through multiple sources depending on the species:
Welcome to the NIF Resources search. From here you can search through a compilation of resources used by NIF and see how data is organized within our community.
You are currently on the Community Resources tab looking through categories and sources that NIF has compiled. You can navigate through those categories from here or change to a different tab to execute your search through. Each tab gives a different perspective on data.
If you have an account on NIF then you can log in from here to get additional features in NIF such as Collections, Saved Searches, and managing Resources.
Here is the search term that is being executed, you can type in anything you want to search for. Some tips to help searching:
You can save any searches you perform for quick access to later from here.
We recognized your search term and included synonyms and inferred terms along side your term to help get the data you are looking for.
If you are logged into NIF you can add data records to your collections to create custom spreadsheets across multiple sources of data.
Here are the sources that were queried against in your search that you can investigate further.
Here are the categories present within NIF that you can filter your data on
Here are the subcategories present within this category that you can filter your data on
If you have any further questions please check out our FAQs Page to ask questions and see our tutorials. Click this button to view this tutorial again.
Welcome to the Neuroscience Information Framework Project, designed to serve the biomedical research community. NIF maintains the largest searchable collection of neuroscience data, the largest catalog of biomedical resources, and the largest ontology for neuroscience on the web. We welcome all feedback and suggestions and are actively looking for resource providers to make their resources accessible through NIF. Learn about the tools available to help you share your data and discover a dynamic inventory of Web-based neuroscience resources.
