Are you sure you want to leave this community? Leaving the community will revoke any permissions you have been granted in this community.
Integrated Animals is a virtual database currently indexing available animal strains and mutants from: AGSC (Ambystoma), BCBC (mice), BDSC (flies), European Xenopus Resource Center (frog), The National Xenopus Resource (frog), Xenopus Express (frog), CWRU Cystic Fibrosis Mouse Models (mice), DGGR (flies), FlyBase (flies), IMSR (mice), MGI (mice), MMRRC (mice), NSRRC (pig), RGD (rats), Sperm Stem Cell Libraries for Biological Research (rats), Tetrahymena Stock Center (Tetrahymena), WormBase (worms), XGSC (Xiphophorus), ZFIN (zebrafish), and ZIRC (zebrafish). Note, the IMSR data is linked, but users may need to re-execute the search if the top mouse is not returned properly.
Note: BCBC is no longer in service, so the links may not be functional.
http://www.wormbase.org/db/get?name=WBStrain00029071
Source Database: WormBase (WB)
Genetic Background:
Affected Genes: WBGene00006454(aex-4)
Genomic Alteration: WBGene00006454(aex-4)
Availability: available
References:
Synonyms: aex-4(n2415) X; jsEx1028.
Alternate IDs: WB-STRAIN:NM3458, CGC_NM3458
Notes: jsEx1028 [aex-4p::GFP::aex + myo-2p::GFP + pBS]. Pick GFP+ to maintain. Reference: Mahoney TR, et al. Proc Natl Acad Sci U S A. 2008 Oct 21;105(42):16350-5.
Proper citation: RRID:WB-STRAIN:WBStrain00029071 Copy
http://www.wormbase.org/db/get?name=WBStrain00029023
Source Database: WormBase (WB)
Genetic Background:
Affected Genes: WBGene00006843(unc-119)
Genomic Alteration: WBGene00006843(unc-119)
Availability: available
References:
Synonyms: unc-119(ed3) III; pkIs1642.
Alternate IDs: WB-STRAIN:NL3909, CGC_NL3909
Notes: pkIs1642[unc-119(+) + R11A8.5(+) + sir-2.1(+)]. Non-Unc strain.|"Reference WBPaper00058832 added based on published strain data identified by Textpresso literature search."
Proper citation: RRID:WB-STRAIN:WBStrain00029023 Copy
http://www.wormbase.org/db/get?name=WBStrain00029026
Source Database: WormBase (WB)
Genetic Background:
Affected Genes: WBGene00004178(prg-1)
Genomic Alteration: WBGene00004178(prg-1)
Availability: available
References:
Synonyms: prg-1 (pk2298) I.
Alternate IDs: WB-STRAIN:NL4110, CGC_NL4110
Notes: Superficially wildtype.
Proper citation: RRID:WB-STRAIN:WBStrain00029026 Copy
http://www.wormbase.org/db/get?name=WBStrain00029017
Source Database: WormBase (WB)
Genetic Background:
Affected Genes: WBGene00001332(eri-1)|WBGene00004027(pie-1)
Genomic Alteration: WBGene00001332(eri-1), WBGene00004027(pie-1)
Availability: available
References:
Synonyms: pkIs32 III; eri-1(mg366) IV.
Alternate IDs: WB-STRAIN:NL3630, CGC_NL3630
Notes: pkIs32[pie-1::GFP::H2B]. RNAi hypersensitive.
Proper citation: RRID:WB-STRAIN:WBStrain00029017 Copy
http://www.wormbase.org/db/get?name=WBStrain00029018
Source Database: WormBase (WB)
Genetic Background:
Affected Genes: WBGene00006759(unc-22)
Genomic Alteration: WBGene00006759(unc-22)
Availability: available
References:
Synonyms: unc-22(st136) IV.
Alternate IDs: WB-STRAIN:NL3643, CGC_NL3643
Notes: Alt Genotype: unc-22(st136)|"Contains Construct Originally made by Dr. Nadine Vastenhouw."|"The unc-22(st136) allele harbors a transposon insertion. Animals have a twitcher phenotype."|"Twitcher Unc. Flanking sequence: agattgacgagatccataaggaaggatgta cattgaactggaagcctccaactgataacg.Twitcher Unc."
Proper citation: RRID:WB-STRAIN:WBStrain00029018 Copy
http://www.wormbase.org/db/get?name=WBStrain00029014
Source Database: WormBase (WB)
Genetic Background:
Affected Genes: WBGene00002016(hsp-16.2)
Genomic Alteration: WBGene00002016(hsp-16.2)
Availability: available
References:
Synonyms: pkIs1605.
Alternate IDs: WB-STRAIN:NL3401, CGC_NL3401
Notes: pkIs1605 [hsp-16.2p::GFP::LacZ + rol-6(su1006)]. Rollers.
Proper citation: RRID:WB-STRAIN:WBStrain00029014 Copy
http://www.wormbase.org/db/get?name=WBStrain00029015
Source Database: WormBase (WB)
Genetic Background:
Affected Genes: WBGene00004093(ppw-1)
Genomic Alteration: WBGene00004093(ppw-1)
Availability: available
References:
Synonyms: ppw-1(pk1425) I.
Alternate IDs: WB-STRAIN:NL3511, CGC_NL3511
Notes: Mutagen:UV/TMP|"ppw-1 animals are resistant to feeding of ds RNA directed against germline genes. The genomic region that is deleted: nt 2479-3982 of C18E3 (intragenic deletion in C18E3.7). This strain was formerly called NL2557."|"Reference WBPaper00058851 added based on published strain data identified by Textpresso literature search."|"Supplementary_genotype [ppw1(pk1425)"|"WBStrain provided so WBPaper00060343 paper added based on AFP_Strain data."
Proper citation: RRID:WB-STRAIN:WBStrain00029015 Copy
http://www.wormbase.org/db/get?name=WBStrain00029096
Source Database: WormBase (WB)
Genetic Background:
Affected Genes: WBGene00006843(unc-119)
Genomic Alteration: WBGene00006843(unc-119)
Availability: available
References:
Synonyms: unc-119(ed3) III; cdIs141.
Alternate IDs: WB-STRAIN:NP1154, CGC_NP1154
Notes: cdIs141[pcc1::mCherry::rab-7 + ttx-3::GFP + unc-119(+)]. Ballistic transformation. mCherry::RAB-7 expressed in front coelomocyte promoter.|"cdIs141[pcc1::mCherry::RAB-7 + unc-119(+) + ttx-3::GFP]. Ballistic transformation. mCherry::RAB-7 expressed in front coelomocyte promoter."
Proper citation: RRID:WB-STRAIN:WBStrain00029096 Copy
http://www.wormbase.org/db/get?name=WBStrain00029097
Source Database: WormBase (WB)
Genetic Background:
Affected Genes: WBGene00013093(cup-14)
Genomic Alteration: WBGene00013093(cup-14)
Availability: available
References:
Synonyms: arIs37 I; cup-14(cd31) II.
Alternate IDs: WB-STRAIN:NP1360, CGC_NP1360
Notes: arIs37 [myo-3p::ssGFP + dpy-20(+)] I. myo-3p::ssGFP is a secreted GFP that is taken up by coelomocytes. Reference: Gee, K et al. (2017) G3 7: 991.|"Made_by: Daniel Zamora"
Proper citation: RRID:WB-STRAIN:WBStrain00029097 Copy
http://www.wormbase.org/db/get?name=WBStrain00029010
Source Database: WormBase (WB)
Genetic Background:
Affected Genes: WBGene00004683(rsd-4)
Genomic Alteration: WBGene00004683(rsd-4)
Availability: available
References:
Synonyms: rsd-4(pk3304) III.
Alternate IDs: WB-STRAIN:NL3304, CGC_NL3304
Notes: Made_by: K.L. Okihara|"Resistant to feeding dsRNA but sensitive to dsRNA injection."
Proper citation: RRID:WB-STRAIN:WBStrain00029010 Copy
http://www.wormbase.org/db/get?name=WBStrain00029011
Source Database: WormBase (WB)
Genetic Background:
Affected Genes: WBGene00004681(rsd-2)
Genomic Alteration: WBGene00004681(rsd-2)
Availability: available
References:
Synonyms: rsd-2(pk3307).
Alternate IDs: WB-STRAIN:NL3307, CGC_NL3307
Notes: Made_by: K.L. Okihara|"Resistant when fed dsRNA. Contains a point mutation at position 13832 (c to t) (R1000 STOP)."|"WBStrain mapped, WBPaper00059605 added based on AFP_Strain data."
Proper citation: RRID:WB-STRAIN:WBStrain00029011 Copy
http://www.wormbase.org/db/get?name=WBStrain00029099
Source Database: WormBase (WB)
Genetic Background:
Affected Genes: WBGene00010191(dmsr-1)
Genomic Alteration: WBGene00010191(dmsr-1)
Availability: available
References:
Synonyms: qnIs303 IV; dmsr-1(qn45) V.
Alternate IDs: WB-STRAIN:NQ792, CGC_NQ792
Notes: Made_by: Mike Iannacone|"qnIs303 [hsp-16.2p::flp-13 + hsp-16.2p::GFP + rab-3p::mCherry] IV. Pumps and moves 2 hours after heat induced flp-13 over-expression. Outcrossed 1x to NQ570. Reference: Iannacone M, et al. eLife 2017."
Proper citation: RRID:WB-STRAIN:WBStrain00029099 Copy
http://www.wormbase.org/db/get?name=WBStrain00029092
Source Database: WormBase (WB)
Genetic Background:
Affected Genes: WBGene00006843(unc-119)
Genomic Alteration: WBGene00006843(unc-119)
Availability: available
References:
Synonyms: unc-119(ed3) III; cdIs85.
Alternate IDs: WB-STRAIN:NP941, CGC_NP941
Notes: cdIs85 [pcc1::2xFYVE::GFP + myo-2p::GFP + unc-119(+)]. Ballistic transformation. 2xFYVE(Hrs)::GFP expressed in front coelomocyte promoter.|"cdIs85 [pcc1::2xFYVE::GFP + unc-119(+) + myo-2::GFP]. Ballistic transformation. 2xFYVE(Hrs)::GFP expressed in front coelomocyte promoter."
Proper citation: RRID:WB-STRAIN:WBStrain00029092 Copy
http://www.wormbase.org/db/get?name=WBStrain00029094
Source Database: WormBase (WB)
Genetic Background:
Affected Genes: WBGene00006843(unc-119)
Genomic Alteration: WBGene00006843(unc-119)
Availability: available
References:
Synonyms: unc-119(ed3) III; cdIs113.
Alternate IDs: WB-STRAIN:NP1086, CGC_NP1086
Notes: cdIs113 [pcc1::mCherry::rab-5 + ttx-3::GFP + unc-119(+)]. Ballistic transformation. mCherry::RAB-5 expressed in front coelomocyte promoter.|"cdIs113[pcc1::mCherry::RAB-5 + unc-119(+) + ttx-3::GFP]. Ballistic transformation. mCherry::RAB-5 expressed in front coelomocyte promoter."
Proper citation: RRID:WB-STRAIN:WBStrain00029094 Copy
http://www.wormbase.org/db/get?name=WBStrain00029095
Source Database: WormBase (WB)
Genetic Background:
Affected Genes: WBGene00006843(unc-119)
Genomic Alteration: WBGene00006843(unc-119)
Availability: available
References:
Synonyms: unc-119(ed3) III; cdIs131.
Alternate IDs: WB-STRAIN:NP1129, CGC_NP1129
Notes: cdIs131 [pcc1::GFP::rab-5 + myo-2p::GFP + unc-119(+)]. Ballistic transformation. GFP::RAB-5 expressed in front coelomocyte promoter.|"cdIs131[pcc1::GFP::RAB-5 + unc-119(+) + myo-2::GFP]. Ballistic transformation. GFP::RAB-5 expressed in front coelomocyte promoter."
Proper citation: RRID:WB-STRAIN:WBStrain00029095 Copy
http://www.wormbase.org/db/get?name=WBStrain00029091
Source Database: WormBase (WB)
Genetic Background:
Affected Genes:
Genomic Alteration:
Availability: available
References:
Synonyms: cdIs80.
Alternate IDs: WB-STRAIN:NP898, CGC_NP898
Notes: cdIs80 [pcc1::PLCd::GFP + rol-6(su1006)]. Rollers.
Proper citation: RRID:WB-STRAIN:WBStrain00029091 Copy
http://www.wormbase.org/db/get?name=WBStrain00029007
Source Database: WormBase (WB)
Genetic Background:
Affected Genes: WBGene00003834(nxf-1)
Genomic Alteration: WBGene00003834(nxf-1)
Availability: available
References:
Synonyms: nxf-1(pk386) V.
Alternate IDs: WB-STRAIN:NL3223, CGC_NL3223
Notes: Suppressor of activated Gs. Temperature sensitive allele.
Proper citation: RRID:WB-STRAIN:WBStrain00029007 Copy
http://www.wormbase.org/db/get?name=WBStrain00029166
Source Database: WormBase (WB)
Genetic Background:
Affected Genes: WBGene00001864(him-5)
Genomic Alteration: WBGene00001864(him-5)
Availability: available
References:
Synonyms: ynIs66 IV; him-5(e1490) V.
Alternate IDs: WB-STRAIN:NY2066, CGC_NY2066
Notes: ynIs66 [flp-7p::GFP].
Proper citation: RRID:WB-STRAIN:WBStrain00029166 Copy
http://www.wormbase.org/db/get?name=WBStrain00029167
Source Database: WormBase (WB)
Genetic Background:
Affected Genes: WBGene00001864(him-5)
Genomic Alteration: WBGene00001864(him-5)
Availability: available
References:
Synonyms: ynIs67 III; him-5(e1490) V.
Alternate IDs: WB-STRAIN:NY2067, CGC_NY2067
Notes: ynIs67 [flp-6p::GFP].
Proper citation: RRID:WB-STRAIN:WBStrain00029167 Copy
http://www.wormbase.org/db/get?name=WBStrain00029200
Source Database: WormBase (WB)
Genetic Background:
Affected Genes: WBGene00006843(unc-119)
Genomic Alteration: WBGene00006843(unc-119)
Availability: available
References:
Synonyms: unc-119(ed3) III; ltIs3.
Alternate IDs: WB-STRAIN:OD7, CGC_OD7
Notes: ltIs3[pIC31; pie-1 promoter::hcp-1::GFP-TEV-STag + unc-119(+)].|"Mutagen:biolistic particle bombardment"
Proper citation: RRID:WB-STRAIN:WBStrain00029200 Copy
Can't find your Organism?
We recommend that you click next to the search bar to check some helpful tips on searches and refine your search firstly. If you want to find a specific organism, it's easier to enter an RRID or a Catalog Number to search. You can refine the search results using Facets on the left side of the search results page. If you are on the table view, you can also search in a specific column by clicking the column title and enter the keywords.
If you still could not find your organism in the search results, please help us by registering it into the system — it's easy. Organisms identifiers are registered through multiple sources depending on the species:
Welcome to the NIF Resources search. From here you can search through a compilation of resources used by NIF and see how data is organized within our community.
You are currently on the Community Resources tab looking through categories and sources that NIF has compiled. You can navigate through those categories from here or change to a different tab to execute your search through. Each tab gives a different perspective on data.
If you have an account on NIF then you can log in from here to get additional features in NIF such as Collections, Saved Searches, and managing Resources.
Here is the search term that is being executed, you can type in anything you want to search for. Some tips to help searching:
You can save any searches you perform for quick access to later from here.
We recognized your search term and included synonyms and inferred terms along side your term to help get the data you are looking for.
If you are logged into NIF you can add data records to your collections to create custom spreadsheets across multiple sources of data.
Here are the sources that were queried against in your search that you can investigate further.
Here are the categories present within NIF that you can filter your data on
Here are the subcategories present within this category that you can filter your data on
If you have any further questions please check out our FAQs Page to ask questions and see our tutorials. Click this button to view this tutorial again.