Are you sure you want to leave this community? Leaving the community will revoke any permissions you have been granted in this community.
Integrated Animals is a virtual database currently indexing available animal strains and mutants from: AGSC (Ambystoma), BCBC (mice), BDSC (flies), European Xenopus Resource Center (frog), The National Xenopus Resource (frog), Xenopus Express (frog), CWRU Cystic Fibrosis Mouse Models (mice), DGGR (flies), FlyBase (flies), IMSR (mice), MGI (mice), MMRRC (mice), NSRRC (pig), RGD (rats), Sperm Stem Cell Libraries for Biological Research (rats), Tetrahymena Stock Center (Tetrahymena), WormBase (worms), XGSC (Xiphophorus), ZFIN (zebrafish), and ZIRC (zebrafish). Note, the IMSR data is linked, but users may need to re-execute the search if the top mouse is not returned properly.
Note: BCBC is no longer in service, so the links may not be functional.
http://www.wormbase.org/db/get?name=WBStrain00050993
Source Database: WormBase (WB)
Affected Genes: WBGene00017034(otpl-2)
Genomic Alteration: WBGene00017034(otpl-2)
Availability: unknown
Source References: EMPTY
Synonyms: otpl-2(sy1579) V.
Notes: Made_by: Heenam Park|"Superficially wild-type. CRISPR/Cas9 engineered STOP-IN null mutant of otpl-2; Universal 43bp-long knock-in insertion with 3-frame stop codon (STOP-IN cassette).Left flanking sequence: CATGAAAATATGAAACGTTGGACGAAAAACCCGGAARight flanking sequence: GCAAGgtaaaaagggaataactcaatataattcinserted sequence between the two flanking sequence (STOP-In casette): GGGAAGTTTGTCCAGAGCAGAGGTGACTAAGTGATAAgctagc. sgRNA : GGACGAAAAACCCGGAAGCA Method Reference: G3 (Bethesda). 2018 Nov 6;8(11):3607-3616"
Proper citation: RRID:WB-STRAIN:WBStrain00050993 Copy
http://www.wormbase.org/db/get?name=WBStrain00050992
Source Database: WormBase (WB)
Affected Genes: WBGene00018573(oac-30)
Genomic Alteration: WBGene00018573(oac-30)
Availability: unknown
Source References: EMPTY
Synonyms: oac-30(sy1577) II.
Notes: Made_by: Heenam Park|"Superficially wild-type. CRISPR/Cas9 engineered STOP-IN null mutant of oac-30; Universal 43bp-long knock-in insertion with 3-frame stop codon (STOP-IN cassette).Left flanking sequence: gtaattttgaaacttgctgaaattttcagATTCCGCCGRight flanking sequence: AATCCTGCCACTCTACTATCTCCTCATCTTCTTAAinserted sequence between the two flanking sequence (STOP-In casette): GGGAAGTTTGTCCAGAGCAGAGGTGACTAAGTGATAAgctagc. sgRNA : AGTAGAGTGGCAGGATTCGGMethod Reference: G3 (Bethesda). 2018 Nov 6;8(11):3607-3616"
Proper citation: RRID:WB-STRAIN:WBStrain00050992 Copy
http://www.wormbase.org/db/get?name=WBStrain00050991
Source Database: WormBase (WB)
Affected Genes: WBGene00009629(sprr-2)
Genomic Alteration: WBGene00009629(sprr-2)
Availability: unknown
Source References: EMPTY
Synonyms: sprr-2(sy1569) X.
Notes: Made_by: Heenam Park|"Superficially wild-type. CRISPR/Cas9 engineered STOP-IN null mutant of sprr-2; Universal 43bp-long knock-in insertion with 3-frame stop codon (STOP-IN cassette).Left flanking sequence: GAAGTTTATTGCGGCAATGCGCATGCAGAGCCAAATRight flanking sequence: AGCTCAGCAGTTCAACAACTTGCAGAAGCATGTGinserted sequence between the two flanking sequence (STOP-In casette): GGGAAGTTTGTCCAGAGCAGAGGTGACTAAGTGATAAgctagc. sgRNA : TGTTGAACTGCTGAGCTATTMethod Reference: G3 (Bethesda). 2018 Nov 6;8(11):3607-3616"
Proper citation: RRID:WB-STRAIN:WBStrain00050991 Copy
http://www.wormbase.org/db/get?name=WBStrain00050997
Source Database: WormBase (WB)
Affected Genes: WBGene00018479(otpl-6)
Genomic Alteration: WBGene00018479(otpl-6)
Availability: unknown
Source References: EMPTY
Synonyms: otpl-6(sy1588) V.
Notes: Made_by: Heenam Park|"Superficially wild-type. CRISPR/Cas9 engineered STOP-IN null mutant of otpl-6; Universal 43bp-long knock-in insertion with 3-frame stop codon (STOP-IN cassette).Left flanking sequence: CAATTGAATCTACATCCAGCGATGTTACTGTCCTAACRight flanking sequence: AGACTATAGCAGTACTATTCCAGAAAATCTTCCGinserted sequence between the two flanking sequence (STOP-In casette): GGGAAGTTTGTCCAGAGCAGAGGTGACTAAGTGATAAgctagc. sgRNA : TAGTACTGCTATAGTCTGTT Method Reference: G3 (Bethesda). 2018 Nov 6;8(11):3607-3616"
Proper citation: RRID:WB-STRAIN:WBStrain00050997 Copy
http://www.wormbase.org/db/get?name=WBStrain00050995
Source Database: WormBase (WB)
Affected Genes: WBGene00018477(otpl-4)
Genomic Alteration: WBGene00018477(otpl-4)
Availability: unknown
Source References: EMPTY
Synonyms: otpl-4(sy1585) V.
Notes: Made_by: Heenam Park|"Superficially wild-type. CRISPR/Cas9 engineered STOP-IN null mutant of otpl-4 ; Universal 43bp-long knock-in insertion with 3-frame stop codon (STOP-IN cassette).Left flanking sequence: GTTTCAATTGTTTTTTATATTATTCTGGGACTGACARight flanking sequence: TCGTGGAAAAAGgtgagaatagcaagatttattcinserted sequence between the two flanking sequence (STOP-In casette): GGGAAGTTTGTCCAGAGCAGAGGTGACTAAGTGATAAgctagc. sgRNA : TTATTCTGGGACTGACATCG Method Reference: G3 (Bethesda). 2018 Nov 6;8(11):3607-3616"
Proper citation: RRID:WB-STRAIN:WBStrain00050995 Copy
http://www.wormbase.org/db/get?name=WBStrain00051030
Source Database: WormBase (WB)
Affected Genes: WBGene00018794(attf-3)
Genomic Alteration: WBGene00018794(attf-3)
Availability: unknown
Source References: EMPTY
Synonyms: attf-3(st12296[attf-3::TY1::EGFP::3xFLAG]) III.
Notes: CRISPR/Cas9 engineered tagged endogenous locus.|"Made_by: DKV/LS/CK"
Proper citation: RRID:WB-STRAIN:WBStrain00051030 Copy
http://www.wormbase.org/db/get?name=WBStrain00051033
Source Database: WormBase (WB)
Affected Genes: WBGene00019079(rpa-4)
Genomic Alteration: WBGene00019079(rpa-4)
Availability: unknown
Source References: EMPTY
Synonyms: rpa-4(iow21) I.
Notes: Made_by: Adam Hefel|"rpa-4(iow21) deletion generated by CRISPR in N2 background. Reference: Hefel et al., Nucleic Acids Res. 2021 Jan 21;gkaa1293. doi: 10.1093/nar/gkaa1293."
Proper citation: RRID:WB-STRAIN:WBStrain00051033 Copy
http://www.wormbase.org/db/get?name=WBStrain00051032
Source Database: WormBase (WB)
Affected Genes: WBGene00004057(pmk-3)
Genomic Alteration: WBGene00004057(pmk-3)
Availability: unknown
Source References: EMPTY
Synonyms: pmk-3(tm745) IV; dvIs67; stxEx12.
Notes: dvIs67 [tbb-6p::GFP + myo-3p::dsRed]. stxEx12 [eft-3p::pmk-3 S(EE)::SL2::mCherry]. Pick animals with mCherry expression in intestinal cells. Reference: Munkacsy E, et al. PLoS Genet. 2016 Jul 15;12(7):e1006133.
Proper citation: RRID:WB-STRAIN:WBStrain00051032 Copy
http://www.wormbase.org/db/get?name=WBStrain00051031
Source Database: WormBase (WB)
Availability: unknown
Source References: PMID:37828862, PMID:37957360
Synonyms: foxEx3.
Notes: foxEx3 [rgef-1p::tomm-20::Rosella]. Pick animals with red fluorescence in neurons to maintain. foxEx3 expresses neuron-specific, mitochondrial localized Rosella, a pH-sensitive fluorescent biosensor for monitoring and analyzing mitophagy. Reference: Cummins N, EMBO J. 2019 Feb 1;38(3):e99360. PMID: 30538104|"Made_by: Andrea Tweedie"|"Supplementary_genotype foxEx3 [rgef-1p::tomm-20::Rosella]"
Proper citation: RRID:WB-STRAIN:WBStrain00051031 Copy
http://www.wormbase.org/db/get?name=WBStrain00050983
Source Database: WormBase (WB)
Affected Genes: WBGene00022605(dmsr-11)
Genomic Alteration: WBGene00022605(dmsr-11)
Availability: unknown
Source References: EMPTY
Synonyms: dmsr-11(sy1551) V.
Notes: Made_by: Heenam Park/Wilber Palma|"Superficially wild-type. CRISPR/Cas9 engineered STOP-IN null mutant of dmsr-11; Universal 43bp-long knock-in insertion with 3-frame stop codon (STOP-IN cassette).Left flanking sequence: CTGAGGCTGCAATTAATAACGGAATTGTTTCCTTCARight flanking sequence: TGGACGCATTAGTAAAgtaatttaaactttagcinserted sequence between the two flanking sequence (STOP-In casette): GGGAAGTTTGTCCAGAGCAGAGGTGACTAAGTGATAAgctagc. sgRNA : CTTTACTAATGCGTCCATGAMethod Reference: G3 (Bethesda). 2018 Nov 6;8(11):3607-3616"
Proper citation: RRID:WB-STRAIN:WBStrain00050983 Copy
http://www.wormbase.org/db/get?name=WBStrain00050982
Source Database: WormBase (WB)
Affected Genes: WBGene00021437(lgc-42)
Genomic Alteration: WBGene00021437(lgc-42)
Availability: unknown
Source References: EMPTY
Synonyms: lgc-42(sy1550) III.
Notes: Made_by: Heenam Park/Wilber Palma|"Superficially wild-type. CRISPR/Cas9 engineered STOP-IN null mutant of lgc-42; Universal 43bp-long knock-in insertion with 3-frame stop codon (STOP-IN cassette).Left flanking sequence: GAAATGGAAATCCGAAGGCTCCGCTGCAAGTGCARight flanking sequence: CTTTGGTTTTTATGTGGAGAGCTTGGGAAATTTCAGinserted sequence between the two flanking sequence (STOP-In casette): GGGAAGTTTGTCCAGAGCAGAGGTGACTAAGTGATAAgctagc. sgRNA : GCTCCGCTGCAAGTGCACTTMethod Reference: G3 (Bethesda). 2018 Nov 6;8(11):3607-3616"
Proper citation: RRID:WB-STRAIN:WBStrain00050982 Copy
http://www.wormbase.org/db/get?name=WBStrain00051037
Source Database: WormBase (WB)
Affected Genes: WBGene00006843(unc-119)|WBGene00017088(akir-1)
Genomic Alteration: WBGene00006843(unc-119), WBGene00017088(akir-1)
Availability: unknown
Source References: EMPTY
Synonyms: akir-1(iow88[GFP11::akir-1]) I; iowSi8 II; unc-119(ed3) III.
Notes: akir-1(iow88[GFP11::akir-1]) I. iowSi8[pie-1p::GFP1-10::him-3 3UTR + Cbr-unc119(+)] II. CRISPR/Cas9 insertion of GFP11 tag into endogenous akir-1 locus in background strain SSM471. GFP::AKIR-1 fluorescence only observed in the germline. If germline silencing occurs, transgene expression can be recovered by growing worms at 25C for 2 generations. Reference: Hefel A & Smolikove S. G3. 2019 Jun 5;9(6):1933-1943. PMID: 30992318.|"Made_by: Adam Hefel"
Proper citation: RRID:WB-STRAIN:WBStrain00051037 Copy
http://www.wormbase.org/db/get?name=WBStrain00050980
Source Database: WormBase (WB)
Affected Genes: WBGene00022606(dmsr-9)
Genomic Alteration: WBGene00022606(dmsr-9)
Availability: unknown
Source References: EMPTY
Synonyms: dmsr-9(sy1546) V.
Notes: Made_by: Heenam Park/Wilber Palma|"Superficially wild-type. CRISPR/Cas9 engineered STOP-IN null mutant of dmsr-9; Universal 43bp-long knock-in insertion with 3-frame stop codon (STOP-IN cassette).Left flanking sequence: CAATATTTTAGCCAATATCCGGAAGCCAATAGTG Right flanking sequence: ACGAGGCAAAAGATTTGTTTATTACTTCATTGATTGinserted sequence between the two flanking sequence (STOP-In casette): GGGAAGTTTGTCCAGAGCAGAGGTGACTAAGTGATAAgctagc. sgRNA : TCCGGAAGCCAATAGTGACGMethod Reference: G3 (Bethesda). 2018 Nov 6;8(11):3607-3616"
Proper citation: RRID:WB-STRAIN:WBStrain00050980 Copy
http://www.wormbase.org/db/get?name=WBStrain00051035
Source Database: WormBase (WB)
Affected Genes: WBGene00019767(rpa-2)
Genomic Alteration: WBGene00019767(rpa-2)
Availability: unknown
Source References: EMPTY
Synonyms: rpa-2(iow49[3xFLAG::rpa-2]) I.
Notes: Made_by: Adam Hefel|"N-terminal 3xFLAG tag inserted into the endogenous rpa-2 locus using Crispr/Cas9. Generated in N2 background. Reference: Hefel et al., Nucleic Acids Res. 2021 Jan 21;gkaa1293. doi: 10.1093/nar/gkaa1293."
Proper citation: RRID:WB-STRAIN:WBStrain00051035 Copy
http://www.wormbase.org/db/get?name=WBStrain00050986
Source Database: WormBase (WB)
Affected Genes: WBGene00012962(dmsr-5)
Genomic Alteration: WBGene00012962(dmsr-5)
Availability: unknown
Source References: EMPTY
Synonyms: dmsr-5(sy1557) III.
Notes: Made_by: Heenam Park/Wilber Palma|"Superficially wild-type. CRISPR/Cas9 engineered STOP-IN null mutant of dmsr-5; Universal 43bp-long knock-in insertion with 3-frame stop codon (STOP-IN cassette).Left flanking sequence: ctttgaaaaaaatggttgcagGGTCTACACAGTATTGRight flanking sequence: CATCGGTATTTATGTCTTTTTGTGTGTTTTTTCGinserted sequence between the two flanking sequence (STOP-In casette): GGGAAGTTTGTCCAGAGCAGAGGTGACTAAGTGATAAgctagc. sgRNA : GGGTCTACACAGTATTGCATMethod Reference: G3 (Bethesda). 2018 Nov 6;8(11):3607-3616"
Proper citation: RRID:WB-STRAIN:WBStrain00050986 Copy
http://www.wormbase.org/db/get?name=WBStrain00050985
Source Database: WormBase (WB)
Affected Genes: WBGene00018798(gnrr-1)
Genomic Alteration: WBGene00018798(gnrr-1)
Availability: unknown
Source References: EMPTY
Synonyms: gnrr-1(sy1555) I.
Notes: Made_by: Heenam Park/Wilber Palma|"Superficially wild-type. CRISPR/Cas9 engineered STOP-IN null mutant of gnrr-1; Universal 43bp-long knock-in insertion with 3-frame stop codon (STOP-IN cassette).Left flanking sequence: GTCAATGATTCTGTTCTATCAATTGTCTTCACATRight flanking sequence: ATTTGGCTTTATTTATTCTGGCATTTGTTGGAAATGinserted sequence between the two flanking sequence (STOP-In casette): GGGAAGTTTGTCCAGAGCAGAGGTGACTAAGTGATAAgctagc. sgRNA : ATCAATTGTCTTCACATATTMethod Reference: G3 (Bethesda). 2018 Nov 6;8(11):3607-3616"
Proper citation: RRID:WB-STRAIN:WBStrain00050985 Copy
http://www.wormbase.org/db/get?name=WBStrain00050989
Source Database: WormBase (WB)
Affected Genes: WBGene00020525(dmsr-15)
Genomic Alteration: WBGene00020525(dmsr-15)
Availability: unknown
Source References: EMPTY
Synonyms: dmsr-15(sy1563) V.
Notes: Made_by: Heenam Park/Wilber Palma|"Superficially wild-type. CRISPR/Cas9 engineered STOP-IN null mutant of dmsr-15; Universal 43bp-long knock-in insertion with 3-frame stop codon (STOP-IN cassette).Left flanking sequence: AAAAAACATGTCAGAAAATAAAAATCGCGGAGATA Right flanking sequence: TTTCGGATTGTCAACAAAATTTGCTCGATTCAAATCinserted sequence between the two flanking sequence (STOP-In casette): GGGAAGTTTGTCCAGAGCAGAGGTGACTAAGTGATAAgctagc. sgRNA : TAAAAATCGCGGAGATATTTMethod Reference: G3 (Bethesda). 2018 Nov 6;8(11):3607-3616"
Proper citation: RRID:WB-STRAIN:WBStrain00050989 Copy
http://www.wormbase.org/db/get?name=WBStrain00050988
Source Database: WormBase (WB)
Affected Genes: WBGene00020524(dmsr-13)
Genomic Alteration: WBGene00020524(dmsr-13)
Availability: unknown
Source References: EMPTY
Synonyms: dmsr-13(sy1561) V.
Notes: Made_by: Heenam Park/Wilber Palma|"Superficially wild-type. CRISPR/Cas9 engineered STOP-IN null mutant of dmsr-13; Universal 43bp-long knock-in insertion with 3-frame stop codon (STOP-IN cassette).Left flanking sequence: CACTGTGCCATATCCGGAGCCGGGCACCGATGAARight flanking sequence: GTTGGGAATAGCACGATTCCATGGTTGATTACTACinserted sequence between the two flanking sequence (STOP-In casette): GGGAAGTTTGTCCAGAGCAGAGGTGACTAAGTGATAAgctagc. sgRNA : AGCCGGGCACCGATGAAGTTMethod Reference: G3 (Bethesda). 2018 Nov 6;8(11):3607-3616"
Proper citation: RRID:WB-STRAIN:WBStrain00050988 Copy
http://www.wormbase.org/db/get?name=WBStrain00051022
Source Database: WormBase (WB)
Affected Genes: WBGene00009202(aptf-4)
Genomic Alteration: WBGene00009202(aptf-4)
Availability: unknown
Source References: EMPTY
Synonyms: aptf-4(st12286[aptf-4::TY1::EGFP::3xFLAG]) II.
Notes: CRISPR/Cas9 engineered tagged endogenous locus.|"Made_by: DKV/LS/CK"
Proper citation: RRID:WB-STRAIN:WBStrain00051022 Copy
http://www.wormbase.org/db/get?name=WBStrain00050972
Source Database: WormBase (WB)
Affected Genes: WBGene00013222(dmsr-6)
Genomic Alteration: WBGene00013222(dmsr-6)
Availability: unknown
Source References: EMPTY
Synonyms: dmsr-6(sy1530) II.
Notes: Made_by: Heenam Park/Wilber Palma|"Superficially wild-type. CRISPR/Cas9 engineered STOP-IN null mutant of dmsr-6. Universal 43bp-long knock-in insertion with 3-frame stop codon (STOP-IN cassette).left flanking sequence: ggaatacttactaatttaaaatttttagCCTATAright flanking sequence: CTCTAACGTTCATCCTTTCTTGTCATTCATCCTATGinserted sequence between the two flanking sequence (STOP-IN cassette): GGGAAGTTTGTCCAGAGCAGAGGTGACTAAGTGATAAgctagc. sgRNA: AAGGATGAACGTTAGAGTATMethod Reference: G3 (Bethesda)."
Proper citation: RRID:WB-STRAIN:WBStrain00050972 Copy
Can't find your Organism?
We recommend that you click next to the search bar to check some helpful tips on searches and refine your search firstly. If you want to find a specific organism, it's easier to enter an RRID or a Catalog Number to search. You can refine the search results using Facets on the left side of the search results page. If you are on the table view, you can also search in a specific column by clicking the column title and enter the keywords.
If you still could not find your organism in the search results, please help us by registering it into the system — it's easy. Organisms identifiers are registered through multiple sources depending on the species:
Welcome to the NIF Resources search. From here you can search through a compilation of resources used by NIF and see how data is organized within our community.
You are currently on the Community Resources tab looking through categories and sources that NIF has compiled. You can navigate through those categories from here or change to a different tab to execute your search through. Each tab gives a different perspective on data.
If you have an account on NIF then you can log in from here to get additional features in NIF such as Collections, Saved Searches, and managing Resources.
Here is the search term that is being executed, you can type in anything you want to search for. Some tips to help searching:
You can save any searches you perform for quick access to later from here.
We recognized your search term and included synonyms and inferred terms along side your term to help get the data you are looking for.
If you are logged into NIF you can add data records to your collections to create custom spreadsheets across multiple sources of data.
Here are the sources that were queried against in your search that you can investigate further.
Here are the categories present within NIF that you can filter your data on
Here are the subcategories present within this category that you can filter your data on
If you have any further questions please check out our FAQs Page to ask questions and see our tutorials. Click this button to view this tutorial again.