Searching the RRID Resource Information Network
Are you sure you want to leave this community? Leaving the community will revoke any permissions you have been granted in this community.
Integrated Animals is a virtual database currently indexing available animal strains and mutants from: AGSC (Ambystoma), BCBC (mice), BDSC (flies), European Xenopus Resource Center (frog), The National Xenopus Resource (frog), Xenopus Express (frog), CWRU Cystic Fibrosis Mouse Models (mice), DGGR (flies), FlyBase (flies), IMSR (mice), MGI (mice), MMRRC (mice), NSRRC (pig), RGD (rats), Sperm Stem Cell Libraries for Biological Research (rats), Tetrahymena Stock Center (Tetrahymena), WormBase (worms), XGSC (Xiphophorus), ZFIN (zebrafish), and ZIRC (zebrafish). Note, the IMSR data is linked, but users may need to re-execute the search if the top mouse is not returned properly.
Note: BCBC is no longer in service, so the links may not be functional.
http://www.wormbase.org/db/get?name=WBStrain00054964
Source Database: WormBase (WB)
Affected Genes: WBGene00019230(ttll-11)
Genomic Alteration: WBGene00019230(ttll-11)
Availability: unknown
Source References: EMPTY
Synonyms: ttll-11(tm4059) IV.
Notes: Phenotypically wild-type for brood size, viability, Dyf and male mating efficiency. Reference: Chawla DG, et al. Biol Open. 2016 Sep 15;5(9):1290-8. doi: 10.1242/bio.017442. PMID: 27635036
Proper citation: RRID:WB-STRAIN:WBStrain00054964 Copy
http://www.wormbase.org/db/get?name=WBStrain00055019
Source Database: WormBase (WB)
Availability: unknown
Source References: EMPTY
Synonyms: otIs833.
Notes: Made_by: Cyril Cros (Hobert Lab)|"otIs833 [egas-4p::TagRFP + unc-122p::GFP]. Reference: Cros C & Hobert O. bioRxiv 2022.04.19.488792; doi: https:"
Proper citation: RRID:WB-STRAIN:WBStrain00055019 Copy
http://www.wormbase.org/db/get?name=WBStrain00055003
Source Database: WormBase (WB)
Affected Genes: WBGene00000455(ceh-34)
Genomic Alteration: WBGene00000455(ceh-34)
Availability: unknown
Source References: EMPTY
Synonyms: ceh-34(ot1014) V; otEx7476.
Notes: Made_by: Berta Vidal (Hobert Lab)|"otEx7476 [ceh-34(fosmid) + myo-3p::mCherry]. Pick mCherry+ to maintain. ot1014 is a CRISPR/Cas9-engineered allele removing the entire ceh-34 locus. ot1014 homozygotes arrest as L1 larvae. Reference: The enteric nervous system of C. elegans is specified by the Sine Oculis-like homeobox gene ceh-34. Vidal B, et al. bioRxiv 2021.11.30.470650; doi: https:"
Proper citation: RRID:WB-STRAIN:WBStrain00055003 Copy
http://www.wormbase.org/db/get?name=WBStrain00055005
Source Database: WormBase (WB)
Affected Genes: WBGene00006775(unc-39)
Genomic Alteration: WBGene00006775(unc-39)
Availability: unknown
Source References: EMPTY
Synonyms: unc-39(ok2137)V; otEx7581.
Notes: Made_by: Cyril Cros|"otEx7581 [unc-39(+) fosmid WRM0636cG07 + inx-6(prom18)::GFP]. Reference: Cros C & Hobert O. bioRxiv 2022.04.19.488792; doi: https:"
Proper citation: RRID:WB-STRAIN:WBStrain00055005 Copy
http://www.wormbase.org/db/get?name=WBStrain00055004
Source Database: WormBase (WB)
Affected Genes: WBGene00000459(ceh-38)|WBGene00000464(ceh-44)|WBGene00015934(ceh-48)
Genomic Alteration: WBGene00000459(ceh-38), WBGene00000464(ceh-44), WBGene00015934(ceh-48)
Availability: unknown
Source References: EMPTY
Synonyms: ceh-38(tm321) II; ceh-44(ot1028) III; ceh-48(tm6112) IV; otIs356 V; otDf1 X.
Notes: Made_by: Eduardo Leyva-Diaz|"otIs356 [rab-3p(prom1)::2xNLS::TagRFP] V. CUT Sextuple mutant animals show reduced pan-neuronal gene expression, impaired locomotion and resistance to aldicarb induced paralysis. otDf1 is a deletion affecting ceh-41, ceh-21, T26C11.9, and ceh-39. Reference: Leyva-Diaz E & Hobert O. Current Biol. 2022 Mar 3;S0960-9822(22)00262-7. PMID: 35259341."
Proper citation: RRID:WB-STRAIN:WBStrain00055004 Copy
http://www.wormbase.org/db/get?name=WBStrain00055001
Source Database: WormBase (WB)
Availability: unknown
Source References: EMPTY
Synonyms: otEx7457.
Notes: Made_by: Maryam Majeed|"otEx7457 [sri-9::mCherry + sri-9p::NLG1::GFP1-10 + cho-1::mCherry + cho-1p::NLG1::GFP11 + unc-122p::GFP]. ADL>AIA GRASP synaptic reporter. Please contact Oliver Hobert prior to publishing work using this strain."
Proper citation: RRID:WB-STRAIN:WBStrain00055001 Copy
http://www.wormbase.org/db/get?name=WBStrain00055000
Source Database: WormBase (WB)
Availability: unknown
Source References: EMPTY
Synonyms: nIs175 IV.
Notes: Made_by: Steven Cook (Hobert L.);Transgene from Horvitz Lab|"nIs175 [ceh-28p::4xNLS::GFP + lin-15(+)] IV. GFP expression in M4 neurons can be used to isolate M4 by FACS. Used by CeNGEN project for RNA-Seq (https:"
Proper citation: RRID:WB-STRAIN:WBStrain00055000 Copy
http://www.wormbase.org/db/get?name=WBStrain00054955
Source Database: WormBase (WB)
Availability: unknown
Source References: PMID:37910615
Synonyms: jsSi1901 II.
Notes: jsSi1901 [loxP + FRT + myo-2p::nls::cyOFP::let-858 3' + mex-5p::FLP::D5::glh-2 3' + FRT3] II. Reference: Nonet ML. Rapid generation of C. elegans single copy transgenes combining RMCE and drug selection. bioRxiv 2023.03.05.531207; doi: https:|"Made_by: Nonet Lab"|"Supplementary_genotype jsSi1901 [loxP FRT myo-2p nls-cyOFP let-858 3' mex-5p FLP D5 glh-2 3' FRT3] II"|"Supplementary_genotype jsSi1901 [loxP FRT myo-2pnls-cyOFP let-858 3' mex-5pFLP D5 glh-2 3' FRT3] II"
Proper citation: RRID:WB-STRAIN:WBStrain00054955 Copy
http://www.wormbase.org/db/get?name=WBStrain00054958
Source Database: WormBase (WB)
Affected Genes: WBGene00001867(him-8)
Genomic Alteration: WBGene00001867(him-8)
Availability: unknown
Source References: EMPTY
Synonyms: jsSi2027 II; him-8(e1489) IV.
Notes: jsSi2027 [loxP::myo-2p::FRT::Scarlet 2x::tbb-2 3' + rps-0p::hygR::unc-54 3' + ori <{Amp} + mex-5p::nls::Cre::glh-2 3' + FRT3] II. Him. Reference: Nonet ML. Rapid generation of C. elegans single copy transgenes combining RMCE and drug selection. bioRxiv 2023.03.05.531207; doi: https:|"Made_by: Nonet Lab"
Proper citation: RRID:WB-STRAIN:WBStrain00054958 Copy
http://www.wormbase.org/db/get?name=WBStrain00054957
Source Database: WormBase (WB)
Availability: unknown
Source References: EMPTY
Synonyms: jsSi2049 V.
Notes: jsSi2049 [loxP::myo-2p::FRT::Scarlet 2x::tbb-2 3' + rps-0p::hygR::unc-54 3' + ori <{Amp} mex-5p::nls::Cre::glh-2 3' + FRT3] V. Reference: Nonet ML. Rapid generation of C. elegans single copy transgenes combining RMCE and drug selection. bioRxiv 2023.03.05.531207; doi: https:|"Made_by: Nonet Lab"
Proper citation: RRID:WB-STRAIN:WBStrain00054957 Copy
http://www.wormbase.org/db/get?name=WBStrain00055007
Source Database: WormBase (WB)
Affected Genes: WBGene00015651(ceh-53)
Genomic Alteration: WBGene00015651(ceh-53)
Availability: unknown
Source References: EMPTY
Synonyms: ceh-53(ot1066) IV.
Notes: Made_by: Burcu Gulez (Hobert Lab)|"ot1066 is an engineered deletion of the full ceh-53 locus. Reference: Vidal B, et al. Elife. 2022 Mar 24;11:e76003. doi: 10.7554/eLife.76003. PMID: 35324425"
Proper citation: RRID:WB-STRAIN:WBStrain00055007 Copy
http://www.wormbase.org/db/get?name=WBStrain00054953
Source Database: WormBase (WB)
Affected Genes: WBGene00001867(him-8)
Genomic Alteration: WBGene00001867(him-8)
Availability: unknown
Source References: EMPTY
Synonyms: jsSi1973 I; him-8(e1489) IV.
Notes: jsSi1973 [mosL + loxP + myo-2p::FRT::nls::mNG::myo-2 3' + <{rps-0p::HygR::unc-54 3'} + ori <{Amp} <{mex-5p::nls::Cre::tbb-2 3'} + FRT3 + mosR] I. Him. Reference: Nonet ML. Rapid generation of C. elegans single copy transgenes combining RMCE and drug selection. bioRxiv 2023.03.05.531207; doi: https:|"Made_by: Nonet Lab"
Proper citation: RRID:WB-STRAIN:WBStrain00054953 Copy
http://www.wormbase.org/db/get?name=WBStrain00054945
Source Database: WormBase (WB)
Availability: unknown
Source References: EMPTY
Synonyms: jsSi1962 I.
Notes: jsSi1962 [mosL::loxP::FRT + myo-2p::nls::CyOFP::let-858 3' + mex-5p::FLP::D5::glh-2 3' + FRT3 mosR] I. Reference: Nonet ML. Rapid generation of C. elegans single copy transgenes combining RMCE and drug selection. bioRxiv 2023.03.05.531207; doi: https:|"Made_by: Nonet Lab"
Proper citation: RRID:WB-STRAIN:WBStrain00054945 Copy
http://www.wormbase.org/db/get?name=WBStrain00054947
Source Database: WormBase (WB)
Availability: unknown
Source References: EMPTY
Synonyms: jsSi1978 V.
Notes: jsSi1978 [loxP::FRT + myo-2p::nls::cyOFP::let-858 3' + mex-5p::FLP::D5::glh-2 3' + FRT3] V. Reference: Nonet ML. Rapid generation of C. elegans single copy transgenes combining RMCE and drug selection. bioRxiv 2023.03.05.531207; doi: https:|"Made_by: Nonet Lab"
Proper citation: RRID:WB-STRAIN:WBStrain00054947 Copy
http://www.wormbase.org/db/get?name=WBStrain00054946
Source Database: WormBase (WB)
Availability: unknown
Source References: EMPTY
Synonyms: jsSi1971 I.
Notes: jsSi1971 [mosL::loxP + mec-4Sp::FRT::nls::cyOFP::myo-2 3' + mex-5p::FLP::D5::glh-2 3' + FRT3 mosR] I. Reference: Nonet ML. Rapid generation of C. elegans single copy transgenes combining RMCE and drug selection. bioRxiv 2023.03.05.531207; doi: https:|"Made_by: Nonet Lab"
Proper citation: RRID:WB-STRAIN:WBStrain00054946 Copy
http://www.wormbase.org/db/get?name=WBStrain00054940
Source Database: WormBase (WB)
Availability: unknown
Source References: EMPTY
Synonyms: jsSi1727 I.
Notes: jsSi1727 [mosL::loxP::myo-2p::FRT::nlsCyOFP::myo-2 3' + mex-5p::FLP D5::glh-2 3' FRT3::mosR] I. Single component rapid RMCE landing site on Chromosome I at jsTi1453. Created from jsTi1453 (and jsSi1710) by two rounds of RMCE. Unpublished as of 5-2-2022. See https:
Proper citation: RRID:WB-STRAIN:WBStrain00054940 Copy
http://www.wormbase.org/db/get?name=WBStrain00054943
Source Database: WormBase (WB)
Availability: unknown
Source References: EMPTY
Synonyms: jsSi1900 II.
Notes: jsSi1900 [loxP::cup-4p::FRT::cyOFP::tbb-2 3' + mex-5p::FLP::D5::glh-2 3' FRT3] II. Reference: Nonet ML. Rapid generation of C. elegans single copy transgenes combining RMCE and drug selection. bioRxiv 2023.03.05.531207; doi: https:|"Made_by: Nonet Lab"
Proper citation: RRID:WB-STRAIN:WBStrain00054943 Copy
http://www.wormbase.org/db/get?name=WBStrain00054942
Source Database: WormBase (WB)
Availability: unknown
Source References: EMPTY
Synonyms: jsSi1837 IV.
Notes: jsSi1837 [loxP::mec-4Sp::FRT::nlsCyOFP::myo-2 3' + mex-5p::FLP D5::glh-2 3' FRT3] IV. Single component rapid RMCE landing site on Chromosome IV adjacent to cxTi10882. Created from jsSi1669 (and jsIs1824) by two rounds of RMCE. Unpublished as of 5-2-2022. See https:
Proper citation: RRID:WB-STRAIN:WBStrain00054942 Copy
http://www.wormbase.org/db/get?name=WBStrain00054938
Source Database: WormBase (WB)
Affected Genes: WBGene00001079(dpy-20)
Genomic Alteration: WBGene00001079(dpy-20)
Availability: unknown
Source References: EMPTY
Synonyms: dpy-20(e1282) IV; pkIs1275.
Notes: Made_by: Plasterk lab|"pkIs1275 [gpc-2::GFP + dpy-20(+)]. Reporter construct includes 2.3 kbp of upstream sequence and most of the gpc-2 open reading frame. 2.5 kbp PCR fragment generated with primers gpc2-1 (TCTGCAGCACGACGATAATC, extended with a SphI site) and gpc2-2 (GTCGATTGGGTTCACAAGTG, extended with a BamHI site) into vector pPD95.77. Reference: Jansen G, et al. EMBO J. 2002 Mar 1;21(5):986-94."
Proper citation: RRID:WB-STRAIN:WBStrain00054938 Copy
http://www.wormbase.org/db/get?name=WBStrain00055058
Source Database: WormBase (WB)
Affected Genes: WBGene00001190(egl-23)|WBGene00001454(flp-11)
Genomic Alteration: WBGene00001190(egl-23), WBGene00001454(flp-11)
Availability: unknown
Source References: EMPTY
Synonyms: flp-11(syb1433[flp-11::SL2::egl-23(cDNA)(A383V)::linker::mKate2]) X.
Notes: egl-23 cDNA(A383V) was knocked into the endogenous locus of flp-11 to express a potassium channel in RIS that causes moderate inactivation of RIS. Reference: Busack I & Bringmann H. PLOS Genetics 19(3): e1010665. https:|"Made_by: Bringmann lab"
Proper citation: RRID:WB-STRAIN:WBStrain00055058 Copy
Can't find your Organism?
We recommend that you click next to the search bar to check some helpful tips on searches and refine your search firstly. If you want to find a specific organism, it's easier to enter an RRID or a Catalog Number to search. You can refine the search results using Facets on the left side of the search results page. If you are on the table view, you can also search in a specific column by clicking the column title and enter the keywords.
If you still could not find your organism in the search results, please help us by registering it into the system — it's easy. Organisms identifiers are registered through multiple sources depending on the species:
Welcome to the NIF Resources search. From here you can search through a compilation of resources used by NIF and see how data is organized within our community.
You are currently on the Community Resources tab looking through categories and sources that NIF has compiled. You can navigate through those categories from here or change to a different tab to execute your search through. Each tab gives a different perspective on data.
If you have an account on NIF then you can log in from here to get additional features in NIF such as Collections, Saved Searches, and managing Resources.
Here is the search term that is being executed, you can type in anything you want to search for. Some tips to help searching:
You can save any searches you perform for quick access to later from here.
We recognized your search term and included synonyms and inferred terms along side your term to help get the data you are looking for.
If you are logged into NIF you can add data records to your collections to create custom spreadsheets across multiple sources of data.
Here are the sources that were queried against in your search that you can investigate further.
Here are the categories present within NIF that you can filter your data on
Here are the subcategories present within this category that you can filter your data on
If you have any further questions please check out our FAQs Page to ask questions and see our tutorials. Click this button to view this tutorial again.
Welcome to the Neuroscience Information Framework Project, designed to serve the biomedical research community. NIF maintains the largest searchable collection of neuroscience data, the largest catalog of biomedical resources, and the largest ontology for neuroscience on the web. We welcome all feedback and suggestions and are actively looking for resource providers to make their resources accessible through NIF. Learn about the tools available to help you share your data and discover a dynamic inventory of Web-based neuroscience resources.
