Searching the RRID Resource Information Network

Our searching services are busy right now. Please try again later

  • Register
X
Forgot Password

If you have forgotten your password you can enter your email here and get a temporary password sent to your email.

X

Leaving Community

Are you sure you want to leave this community? Leaving the community will revoke any permissions you have been granted in this community.

No
Yes

Integrated Animals is a virtual database currently indexing available animal strains and mutants from: AGSC (Ambystoma), BCBC (mice), BDSC (flies), European Xenopus Resource Center (frog), The National Xenopus Resource (frog), Xenopus Express (frog), CWRU Cystic Fibrosis Mouse Models (mice), DGGR (flies), FlyBase (flies), IMSR (mice), MGI (mice), MMRRC (mice), NSRRC (pig), RGD (rats), Sperm Stem Cell Libraries for Biological Research (rats), Tetrahymena Stock Center (Tetrahymena), WormBase (worms), XGSC (Xiphophorus), ZFIN (zebrafish), and ZIRC (zebrafish). Note, the IMSR data is linked, but users may need to re-execute the search if the top mouse is not returned properly.
Note: BCBC is no longer in service, so the links may not be functional.

Suggested Search Criteria

Enter extra filters to help narrow your search

Search

Type in a keyword to search
Reset search
On page 102 showing 2021 ~ 2040 out of 40,344 results
Snippet view Table view Download Top 1000 Results

Can't find the RRID you're searching for? X
Click the to add this resource to a Collection

    • RRID:WB-STRAIN:WBStrain00005393

    This resource has 1+ mentions.

http://www.wormbase.org/db/get?name=WBStrain00005393

Source Database: WormBase (WB)
Affected Genes: WBGene00006869(vab-2)
Genomic Alteration: WBGene00006869(vab-2)
Availability: available
Source References: EMPTY
Synonyms: vab-2(ju1) IV.
Alternate IDs: WB-STRAIN:CZ4111, CGC_CZ4111
Notes: vab-2(ju1) has embryonic lethality (12%) and notched heads (about 40%). vab-2(ju1) is considered a null allele (W30opal). pka efn-1.

Proper citation: RRID:WB-STRAIN:WBStrain00005393 Copy   

    • RRID:WB-STRAIN:WBStrain00005309

    This resource has 1+ mentions.

http://www.wormbase.org/db/get?name=WBStrain00005309

Source Database: WormBase (WB)
Availability: available
Source References: PMID:22301316, PMID:33820969, PMID:38564369
Synonyms: Caenorhabditis elegans wild isolate.
Alternate IDs: WB-STRAIN:CX11307, CGC_CX11307
Notes: Made_by: A. Sivasundar|"Maintain under normal conditions. Reference: Andersen EC, Nat Genet. 2012 Jan 29;44(3):285-90."

Proper citation: RRID:WB-STRAIN:WBStrain00005309 Copy   

    • RRID:WB-STRAIN:WBStrain00005305

    This resource has 1+ mentions.

http://www.wormbase.org/db/get?name=WBStrain00005305

Source Database: WormBase (WB)
Availability: available
Source References: PMID:33820969, PMID:38564369
Synonyms: Caenorhabditis elegans wild isolate.
Alternate IDs: WB-STRAIN:CX11285, CGC_CX11285
Notes: Made_by: A. Sivasundar|"Maintain under normal conditions. Reference: Andersen EC, Nat Genet. 2012 Jan 29;44(3):285-90."

Proper citation: RRID:WB-STRAIN:WBStrain00005305 Copy   

    • RRID:WB-STRAIN:WBStrain00005388

    This resource has 1+ mentions.

http://www.wormbase.org/db/get?name=WBStrain00005388

Source Database: WormBase (WB)
Affected Genes: WBGene00001553(gcy-33)
Genomic Alteration: WBGene00001553(gcy-33)
Availability: available
Source References: EMPTY
Synonyms: gcy-33(ok232) V.
Alternate IDs: WB-STRAIN:CZ3715, CGC_CZ3715
Notes: 1237bp deletion in cosmid F57F5. Break points are 743 and 1980 with respect to F57F5. Sequence at the break point is: TGAGAAGTTTATAAAAAAGTA / AAACTTAAGAGTTTTCAGTCA. Primers: ok232u1: GGATTGCTTACGTGCATC; ok232d1: ATTACATTTGCAGAAACTCG; ok232d2: CTCTTCTCACTCAAATGATG. ok232u1/d1 = 322bp product with WT allele. ok232d2/u1 = 397bp product with ok232 allele.|"Mutagen:UV/TMP"

Proper citation: RRID:WB-STRAIN:WBStrain00005388 Copy   

    • RRID:WB-STRAIN:WBStrain00005331

    This resource has 1+ mentions.

http://www.wormbase.org/db/get?name=WBStrain00005331

Source Database: WormBase (WB)
Affected Genes: WBGene00021983(npr-5)
Genomic Alteration: WBGene00021983(npr-5)
Availability: available
Source References: PMID:38446031, PMID:38573858
Synonyms: npr-5(ok1583) V.
Alternate IDs: WB-STRAIN:CX14394, CGC_CX14394
Notes: Derived by outcrossing RB1393 five times to N2. Reference: Flavell SW, et al. Cell. 2013 Aug 29;154(5):1023-35.|"Made_by: Steven Flavell"

Proper citation: RRID:WB-STRAIN:WBStrain00005331 Copy   

    • RRID:WB-STRAIN:WBStrain00005330

    This resource has 1+ mentions.

http://www.wormbase.org/db/get?name=WBStrain00005330

Source Database: WormBase (WB)
Affected Genes: WBGene00015735(pdfr-1)
Genomic Alteration: WBGene00015735(pdfr-1)
Availability: available
Source References: PMID:32510332, PMID:38573858
Synonyms: pdfr-1(ok3425) III.
Alternate IDs: WB-STRAIN:CX14295, CGC_CX14295
Notes: Decreased locomotion on food. Derived by outcrossing VC2609 five times to N2. Reference: Flavell SW, et al. Cell. 2013 Aug 29;154(5):1023-35.|"Made_by: Steven Flavell"|"WBStrain mapped, WBPaper00059778 added based on AFP_Strain data."

Proper citation: RRID:WB-STRAIN:WBStrain00005330 Copy   

    • RRID:WB-STRAIN:WBStrain00005327

    This resource has 1+ mentions.

http://www.wormbase.org/db/get?name=WBStrain00005327

Source Database: WormBase (WB)
Affected Genes: WBGene00006411(octr-1)
Genomic Alteration: WBGene00006411(octr-1)
Availability: available
Source References: PMID:32847964
Synonyms: octr-1(ok371) X.
Alternate IDs: WB-STRAIN:CX13079, CGC_CX13079
Notes: Derived by outcrossing VC224 four times to N2. Reference: Flavell SW, et al. Cell. 2013 Aug 29;154(5):1023-35.|"Made_by: Steven Flavell"|"WBStrain provided so WBPaper00060134 paper added based on AFP_Strain data."

Proper citation: RRID:WB-STRAIN:WBStrain00005327 Copy   

    • RRID:WB-STRAIN:WBStrain00005482

    This resource has 1+ mentions.

http://www.wormbase.org/db/get?name=WBStrain00005482

Source Database: WormBase (WB)
Affected Genes: WBGene00001135(eat-4)
Genomic Alteration: WBGene00001135(eat-4)
Availability: available
Source References: PMID:8462849, PMID:31306683
Synonyms: eat-4(ad572) III.
Alternate IDs: WB-STRAIN:DA572, CGC_DA572
Notes: Starved appearance. Reverts spontaneously-Do not passage! Clone starved-looking progeny with abnormal fast pharyngeal pumping to maintain.

Proper citation: RRID:WB-STRAIN:WBStrain00005482 Copy   

    • RRID:WB-STRAIN:WBStrain00005496

    This resource has 1+ mentions.

http://www.wormbase.org/db/get?name=WBStrain00005496

Source Database: WormBase (WB)
Affected Genes: WBGene00001134(eat-3)|WBGene00001867(him-8)
Genomic Alteration: WBGene00001134(eat-3), WBGene00001867(him-8)
Availability: available
Source References: PMID:8462849
Synonyms: eat-3(ad426) II; him-8(e1489) IV.
Alternate IDs: WB-STRAIN:DA631, CGC_DA631
Notes: Abnormal feeding. Slow, irregular feeding. eat-3 exhibits strong maternal effect; dauers seldom recover; Him.|"WBStrain mapped, WBPaper00061409 added based on AFP_Strain data."|"WBStrain mapped, WBPaper00061527 added based on AFP_Strain data."

Proper citation: RRID:WB-STRAIN:WBStrain00005496 Copy   

    • RRID:WB-STRAIN:WBStrain00005493

    This resource has 1+ mentions.

http://www.wormbase.org/db/get?name=WBStrain00005493

Source Database: WormBase (WB)
Affected Genes: WBGene00003807(npr-1)
Genomic Alteration: WBGene00003807(npr-1)
Availability: available
Source References: PMID:18993077, PMID:34038721, PMID:37572357, PMID:38446031
Synonyms: npr-1(ad609) X.
Alternate IDs: WB-STRAIN:DA609, CGC_DA609
Notes: Causes worms to aggregate (Bor). Social.|"Supplementary_genotype npr-1(ad609)"|"WBStrain mapped, WBPaper00061439 added based on AFP_Strain data."|"WBStrain provided so WBPaper00061436 paper added based on AFP_Strain data."

Proper citation: RRID:WB-STRAIN:WBStrain00005493 Copy   

    • RRID:WB-STRAIN:WBStrain00005418

    This resource has 1+ mentions.

http://www.wormbase.org/db/get?name=WBStrain00005418

Source Database: WormBase (WB)
Affected Genes: WBGene00000042(acr-2)
Genomic Alteration: WBGene00000042(acr-2)
Availability: available
Source References: EMPTY
Synonyms: acr-2(n2595 n2420) X.
Alternate IDs: WB-STRAIN:CZ9676, CGC_CZ9676
Notes: Intragenic suppression of n2420 gain of function; n2595 is a nonsense mutation of acr-2. G to A at residue 525, causing W175-STOP. (WT: CACGGAGATGTGACATGGGTCCCACCTGCAATGTT) (n2595: CACGGAGATGTGACATGAGTCCCACCTGCAATGTT). Reference: Jospin M, et al. PLoS Biol. 2009 Dec;7(12):e1000265.|"Made_by: Tammy Stawicki"

Proper citation: RRID:WB-STRAIN:WBStrain00005418 Copy   

    • RRID:WB-STRAIN:WBStrain00005421

    This resource has 1+ mentions.

http://www.wormbase.org/db/get?name=WBStrain00005421

Source Database: WormBase (WB)
Availability: available
Source References: PMID:31983639, PMID:38134228, PMID:38783998, PMID:39378880, PMID:39746999
Synonyms: zdIs5 I.
Alternate IDs: WB-STRAIN:CZ10175, CGC_CZ10175
Notes: WBStrain provided so WBPaper00060426 paper added based on AFP_Strain data.|"zdIs5 [mec-4p::GFP + lin-15(+)] I. SK4005 was outcrossed 10x to produce this strain."

Proper citation: RRID:WB-STRAIN:WBStrain00005421 Copy   

    • RRID:WB-STRAIN:WBStrain00005441

    This resource has 1+ mentions.

http://www.wormbase.org/db/get?name=WBStrain00005441

Source Database: WormBase (WB)
Affected Genes: WBGene00004443(rpl-29)
Genomic Alteration: WBGene00004443(rpl-29)
Availability: available
Source References: EMPTY
Synonyms: juSi123 II; rpl-29(tm3555) IV.
Alternate IDs: WB-STRAIN:CZ18550, CGC_CZ18550
Notes: juSi123 [rpl-29::GFP] II. Strong GFP signal allowing visualization of ribosomes. GFP inserted at C-terminus of RPL-29. Reference: Noma et al Elife. 2017 Aug 2;6. pii: e26376. doi: 10.7554/eLife.26376.|"Made_by: Ken Noma"

Proper citation: RRID:WB-STRAIN:WBStrain00005441 Copy   

    • RRID:WB-STRAIN:WBStrain00005435

    This resource has 1+ mentions.

http://www.wormbase.org/db/get?name=WBStrain00005435

Source Database: WormBase (WB)
Availability: available
Source References: PMID:34534446, PMID:37980357, PMID:38797871
Synonyms: juIs76 [unc-25p::GFP + lin-15(+)] II
Alternate IDs: WB-STRAIN:CZ13799, CGC_CZ13799
Notes: juIs76 [unc-25p::GFP + lin-15(+)] II. GFP expression in GABAergic motor neurons. [NOTE: (10/11/2018) CZ13799 was sent as a replacement for CZ1200, which was found to carry background mutations affecting neuron morphology.] Derived by outcrossing CZ1200 to remove lin-15(n765) and unidentified background mutations. Reference (for original juIs76 strain): Huang X, et al. Neuron. 2002 May 16;34(4):563-76.|"Supplementary_genotype juIs76"

Proper citation: RRID:WB-STRAIN:WBStrain00005435 Copy   

    • RRID:WB-STRAIN:WBStrain00005461

    This resource has 1+ mentions.

http://www.wormbase.org/db/get?name=WBStrain00005461

Source Database: WormBase (WB)
Affected Genes: WBGene00001133(eat-2)
Genomic Alteration: WBGene00001133(eat-2)
Availability: available
Source References: EMPTY
Synonyms: eat-2(ad453) II.
Alternate IDs: WB-STRAIN:DA453, CGC_DA453
Notes: Eat. Scrawny. Slow pumping.

Proper citation: RRID:WB-STRAIN:WBStrain00005461 Copy   

    • RRID:WB-STRAIN:WBStrain00005590

    This resource has 1+ mentions.

http://www.wormbase.org/db/get?name=WBStrain00005590

Source Database: WormBase (WB)
Affected Genes: WBGene00004780(ser-7)
Genomic Alteration: WBGene00004780(ser-7)
Availability: available
Source References: PMID:33007049, PMID:38514005, PMID:39025433
Synonyms: ser-7(tm1325) X
Alternate IDs: WB-STRAIN:DA2100, CGC_DA2100
Notes: Lack of 5HT stimulation of pumping. Primers GGCCTGCCTTCCTGACATGT, CGCGGATTCTCTATCAATAG, ATCCTG GAGCTGGCGAGTTA, GACTGTAAACGCGCAGAGTC. Mutation site 42634-42635 - GGGAANNAAAACCCTCCCTNNANNANNATNNGCANNCC - 43376-43377. 742 bp deletion + 38 bp insertion.|"Mutagen:UV/TMP"|"WBStrain mapped, WBPaper00060976 added based on AFP_Strain data."|"WBStrain provided so WBPaper00060405 paper added based on AFP_Strain data."

Proper citation: RRID:WB-STRAIN:WBStrain00005590 Copy   

    • RRID:WB-STRAIN:WBStrain00005599

    This resource has 1+ mentions.

http://www.wormbase.org/db/get?name=WBStrain00005599

Source Database: WormBase (WB)
Affected Genes: WBGene00003232(mgl-1)|WBGene00003233(mgl-2)
Genomic Alteration: WBGene00003232(mgl-1), WBGene00003233(mgl-2)
Availability: available
Source References: PMID:38362034
Synonyms: mgl-2(tm355) I; mgl-1(tm1811) X.
Alternate IDs: WB-STRAIN:DA2250, CGC_DA2250
Notes: Superficially wild-type; multiple subtle phenotypes related to nutritional response. References: Kang C, You YJ, Avery L. Genes Dev. 2007 Sep 1;21(17):2161-71. Kang C, Avery L. Genes Dev. 2009 Jan 1;23(1):12-7.

Proper citation: RRID:WB-STRAIN:WBStrain00005599 Copy   

    • RRID:WB-STRAIN:WBStrain00005598

    This resource has 1+ mentions.

http://www.wormbase.org/db/get?name=WBStrain00005598

Source Database: WormBase (WB)
Affected Genes: WBGene00004978(spg-7)
Genomic Alteration: WBGene00004978(spg-7)
Availability: available
Source References: EMPTY
Synonyms: spg-7(ad2249) I.
Alternate IDs: WB-STRAIN:DA2249, CGC_DA2249
Notes: Hemiasterlin resistant. Maintain under normal conditions. Reference: Zubovych IO, et al. Mol Biol Cell. 2010 Mar 15;21(6):956-69.

Proper citation: RRID:WB-STRAIN:WBStrain00005598 Copy   

    • RRID:WB-STRAIN:WBStrain00005520

    This resource has 1+ mentions.

http://www.wormbase.org/db/get?name=WBStrain00005520

Source Database: WormBase (WB)
Affected Genes: WBGene00001196(egl-30)
Genomic Alteration: WBGene00001196(egl-30)
Availability: available
Source References: PMID:8630258
Synonyms: egl-30(ad805) I.
Alternate IDs: WB-STRAIN:DA823, CGC_DA823
Notes: Made_by: Duttweiler/Avery|"Suppressor of gpb-2 (a.k.a. eat-11) arecoline hypersensitivity. Unc. Egl."

Proper citation: RRID:WB-STRAIN:WBStrain00005520 Copy   

    • RRID:WB-STRAIN:WBStrain00005547

    This resource has 1+ mentions.

http://www.wormbase.org/db/get?name=WBStrain00005547

Source Database: WormBase (WB)
Affected Genes: WBGene00001133(eat-2)
Genomic Alteration: WBGene00001133(eat-2)
Availability: available
Source References: PMID:31797327, PMID:33602504, PMID:33654835, PMID:37450052, PMID:38590801
Synonyms: eat-2(ad1113) II.
Alternate IDs: WB-STRAIN:DA1113, CGC_DA1113
Notes: Eat. Slow pumping.|"WBStrain mapped, WBPaper00061072 added based on AFP_Strain data."|"WBStrain mapped, WBPaper00061110 added based on AFP_Strain data."

Proper citation: RRID:WB-STRAIN:WBStrain00005547 Copy   

Can't find your Organism?

We recommend that you click next to the search bar to check some helpful tips on searches and refine your search firstly. If you want to find a specific organism, it's easier to enter an RRID or a Catalog Number to search. You can refine the search results using Facets on the left side of the search results page. If you are on the table view, you can also search in a specific column by clicking the column title and enter the keywords.

If you still could not find your organism in the search results, please help us by registering it into the system — it's easy. Organisms identifiers are registered through multiple sources depending on the species:

Can't find the RRID you're searching for? X

  1. Neuroscience Information Framework Resources

    Welcome to the NIF Resources search. From here you can search through a compilation of resources used by NIF and see how data is organized within our community.

  2. Navigation

    You are currently on the Community Resources tab looking through categories and sources that NIF has compiled. You can navigate through those categories from here or change to a different tab to execute your search through. Each tab gives a different perspective on data.

  3. Logging in and Registering

    If you have an account on NIF then you can log in from here to get additional features in NIF such as Collections, Saved Searches, and managing Resources.

  4. Searching

    Here is the search term that is being executed, you can type in anything you want to search for. Some tips to help searching:

    1. Use quotes around phrases you want to match exactly
    2. You can manually AND and OR terms to change how we search between words
    3. You can add "-" to terms to make sure no results return with that term in them (ex. Cerebellum -CA1)
    4. You can add "+" to terms to require they be in the data
    5. Using autocomplete specifies which branch of our semantics you with to search and can help refine your search

  5. Save Your Search

    You can save any searches you perform for quick access to later from here.

  6. Query Expansion

    We recognized your search term and included synonyms and inferred terms along side your term to help get the data you are looking for.

  7. Collections

    If you are logged into NIF you can add data records to your collections to create custom spreadsheets across multiple sources of data.

  8. Sources

    Here are the sources that were queried against in your search that you can investigate further.

  9. Categories

    Here are the categories present within NIF that you can filter your data on

  10. Subcategories

    Here are the subcategories present within this category that you can filter your data on

  11. Further Questions

    If you have any further questions please check out our FAQs Page to ask questions and see our tutorials. Click this button to view this tutorial again.

X

About

Welcome to the Neuroscience Information Framework Project, designed to serve the biomedical research community. NIF maintains the largest searchable collection of neuroscience data, the largest catalog of biomedical resources, and the largest ontology for neuroscience on the web.  We welcome all feedback and suggestions and are actively looking for resource providers to make their resources accessible through NIF. Learn about the tools available to help you share your data and discover a dynamic inventory of Web-based neuroscience resources.

Recent News Entries

Recommendations for repositories and scientific gateways from a neuroscience perspective

NEURON course at the CNS meeting

Neuron Course this year has just been announced!

Contact Us

About SciCrunch | Privacy Policy | Terms of Service

SciCrunch