Are you sure you want to leave this community? Leaving the community will revoke any permissions you have been granted in this community.
Integrated Animals is a virtual database currently indexing available animal strains and mutants from: AGSC (Ambystoma), BCBC (mice), BDSC (flies), European Xenopus Resource Center (frog), The National Xenopus Resource (frog), Xenopus Express (frog), CWRU Cystic Fibrosis Mouse Models (mice), DGGR (flies), FlyBase (flies), IMSR (mice), MGI (mice), MMRRC (mice), NSRRC (pig), RGD (rats), Sperm Stem Cell Libraries for Biological Research (rats), Tetrahymena Stock Center (Tetrahymena), WormBase (worms), XGSC (Xiphophorus), ZFIN (zebrafish), and ZIRC (zebrafish). Note, the IMSR data is linked, but users may need to re-execute the search if the top mouse is not returned properly.
Note: BCBC is no longer in service, so the links may not be functional.
http://www.wormbase.org/db/get?name=WBStrain00005220
Source Database: WormBase (WB)
Affected Genes: WBGene00003848(odr-1)
Genomic Alteration: WBGene00003848(odr-1)
Availability: available
Source References: PMID:8348618, PMID:21173231, PMID:36652499, PMID:38302462
Synonyms: odr-1(n1936) X.
Alternate IDs: WB-STRAIN:CX2065, CGC_CX2065
Notes: Defective chemotaxis to some volatile odorants: benzaldehyde, 2-butanone, isoamyl alcohol. [NOTE: the n1936 mutation is a G-to-A substitution at the end of the second exon (donor site). N2: 5'AGTTGAGGTAATTCA3'. n1936: 5'AGTTGAGATAATTCA3'. Recommended sequencing primers: FWD 5'gcaggagctcacatcggtta3'; REV 5'ttggaatcacatcctgcatga3'.]
Proper citation: RRID:WB-STRAIN:WBStrain00005220 Copy
http://www.wormbase.org/db/get?name=WBStrain00005218
Source Database: WormBase (WB)
Affected Genes: WBGene00000446(ceh-23)|WBGene00000998(dig-1)
Genomic Alteration: WBGene00000446(ceh-23), WBGene00000998(dig-1)
Availability: available
Source References: PMID:10409513
Synonyms: dig-1(ky188) III; kyIs4 X.
Alternate IDs: WB-STRAIN:CX188, CGC_CX188
Notes: kyIs4 [ceh-23p::unc-76::GFP + lin-15(+)] X. kyIs4 contains a fragment of unc-76 protein that drives enrichment of GFP in the axons. Posteriorly displaced nerve ring axons. This strain may contain lin-15(n765) X. Do not distribute this strain; other labs should request it from the CGC. This strain cannot be distributed to commercial organizations. This strain cannot be used for any commercial purpose or for work on human subjects.
Proper citation: RRID:WB-STRAIN:WBStrain00005218 Copy
http://www.wormbase.org/db/get?name=WBStrain00005219
Source Database: WormBase (WB)
Affected Genes: WBGene00006365(syg-1)
Genomic Alteration: WBGene00006365(syg-1)
Availability: available
Source References: PMID:32857970
Synonyms: kyIs235 V; syg-1(ky652) X.
Alternate IDs: WB-STRAIN:CX652, CGC_CX652
Notes: kyIs235 [unc-86::snb-1::YFP + unc-4p::lin-10::RFP(intron) + odr-1::RFP]. Also known as unc-86::VAMP::YFP. Do not distribute this strain; other labs should request it from the CGC. This strain cannot be distributed to commercial organizations. This strain cannot be used for any commercial purpose or for work on human subjects.|"WBStrain mapped, WBPaper00060142 added based on AFP_Strain data."
Proper citation: RRID:WB-STRAIN:WBStrain00005219 Copy
http://www.wormbase.org/db/get?name=WBStrain00005216
Source Database: WormBase (WB)
Affected Genes: WBGene00003856(odr-10)
Genomic Alteration: WBGene00003856(odr-10)
Availability: available
Source References: PMID:8601313, PMID:36652499, PMID:38514005
Synonyms: odr-10(ky32) X
Alternate IDs: WB-STRAIN:CX32, CGC_CX32
Notes: Impaired chemotaxis to low concentrations of the odorant diacetyl.
Proper citation: RRID:WB-STRAIN:WBStrain00005216 Copy
http://www.wormbase.org/db/get?name=WBStrain00005217
Source Database: WormBase (WB)
Affected Genes: WBGene00001130(dyn-1)
Genomic Alteration: WBGene00001130(dyn-1)
Availability: available
Source References: PMID:9294229, PMID:35065714
Synonyms: dyn-1(ky51) X.
Alternate IDs: WB-STRAIN:CX51, CGC_CX51
Notes: ky51 animals are WT (or nearly WT) for locomotion, defecation rate, egg laying and fertility at 15C and 20C. Become Unc within 60 seconds when shifted to 25C. Recover when shifted back to 15C or 20C. dyn-1 encodes a dynamin GTPase. Received new stock from Cori Bargmann Jan 2005.
Proper citation: RRID:WB-STRAIN:WBStrain00005217 Copy
http://www.wormbase.org/db/get?name=WBStrain00005215
Source Database: WormBase (WB)
Affected Genes: WBGene00000078(adp-1)
Genomic Alteration: WBGene00000078(adp-1)
Availability: available
Source References: PMID:7718242, PMID:38302462
Synonyms: adp-1(ky20) II.
Alternate IDs: WB-STRAIN:CX20, CGC_CX20
Notes: Defective in adaptation to a subset of AWC-sensed odorants. Dominant.|"Made_by: Colbert/Bargmann"
Proper citation: RRID:WB-STRAIN:WBStrain00005215 Copy
http://www.wormbase.org/db/get?name=WBStrain00005212
Source Database: WormBase (WB)
Affected Genes: WBGene00003853(odr-6)
Genomic Alteration: WBGene00003853(odr-6)
Availability: available
Source References: EMPTY
Synonyms: odr-6(ky1) II.
Alternate IDs: WB-STRAIN:CX1, CGC_CX1
Notes: EMPTY
Proper citation: RRID:WB-STRAIN:WBStrain00005212 Copy
http://www.wormbase.org/db/get?name=WBStrain00005213
Source Database: WormBase (WB)
Affected Genes: WBGene00003854(odr-7)
Genomic Alteration: WBGene00003854(odr-7)
Availability: available
Source References: PMID:8001144, PMID:37258276, PMID:38421867, PMID:38448519
Synonyms: odr-7(ky4) X.
Alternate IDs: WB-STRAIN:CX4, CGC_CX4
Notes: odr-7 mutants fail to respond to odorants sensed by the AWA neurons.|"Supplementary_genotype odr-7(ky04)"
Proper citation: RRID:WB-STRAIN:WBStrain00005213 Copy
http://www.wormbase.org/db/get?name=WBStrain00005354
Source Database: WormBase (WB)
Affected Genes: WBGene00000042(acr-2)
Genomic Alteration: WBGene00000042(acr-2)
Availability: available
Source References: PMID:37416472, PMID:38421866
Synonyms: juIs14 IV.
Alternate IDs: WB-STRAIN:CZ631, CGC_CZ631
Notes: juIs14 [acr-2p::GFP + lin-15(+)] IV. GFP expression in cholinergic motor neurons. Reference: Hallam SJ, et al. Development. 2000 Oct;127(19):4239-52.
Proper citation: RRID:WB-STRAIN:WBStrain00005354 Copy
http://www.wormbase.org/db/get?name=WBStrain00005351
Source Database: WormBase (WB)
Affected Genes: WBGene00006868(vab-1)
Genomic Alteration: WBGene00006868(vab-1)
Availability: available
Source References: EMPTY
Synonyms: vab-1(ju8) II.
Alternate IDs: WB-STRAIN:CZ429, CGC_CZ429
Notes: EMPTY
Proper citation: RRID:WB-STRAIN:WBStrain00005351 Copy
http://www.wormbase.org/db/get?name=WBStrain00005349
Source Database: WormBase (WB)
Affected Genes: WBGene00006868(vab-1)
Genomic Alteration: WBGene00006868(vab-1)
Availability: available
Source References: PMID:9506518
Synonyms: vab-1(e699) II.
Alternate IDs: WB-STRAIN:CZ414, CGC_CZ414
Notes: Intermediate Vab-1 phenotype. About 9% embryonic lethality and about 20% larval lethality. CB699 outcrossed 2X to N2 to make CZ414.
Proper citation: RRID:WB-STRAIN:WBStrain00005349 Copy
http://www.wormbase.org/db/get?name=WBStrain00005346
Source Database: WormBase (WB)
Affected Genes: WBGene00006868(vab-1)
Genomic Alteration: WBGene00006868(vab-1)
Availability: available
Source References: PMID:9506518, PMID:36975724
Synonyms: vab-1(dx31) II.
Alternate IDs: WB-STRAIN:CZ337, CGC_CZ337
Notes: Strong Vab-1 phenotype. About 50% embryonic lethality and about 30% larval lethality. Genetic null.
Proper citation: RRID:WB-STRAIN:WBStrain00005346 Copy
http://www.wormbase.org/db/get?name=WBStrain00005347
Source Database: WormBase (WB)
Affected Genes: WBGene00006868(vab-1)
Genomic Alteration: WBGene00006868(vab-1)
Availability: available
Source References: EMPTY
Synonyms: vab-1(e856) II.
Alternate IDs: WB-STRAIN:CZ375, CGC_CZ375
Notes: EMPTY
Proper citation: RRID:WB-STRAIN:WBStrain00005347 Copy
http://www.wormbase.org/db/get?name=WBStrain00005345
Source Database: WormBase (WB)
Affected Genes: WBGene00006762(unc-25)
Genomic Alteration: WBGene00006762(unc-25)
Availability: available
Source References: PMID:20530643, PMID:31415799, PMID:32034695, PMID:32209461, PMID:32356725, PMID:37432924, PMID:37639584
Synonyms: juIs1[unc-25::SNB-1::GFP] IV and CL6155: tdp-1(ok781) II; juIs1[unc-25::SNB-1::GFP] IV.
Alternate IDs: WB-STRAIN:CZ333, CGC_CZ333
Notes: juIs1 [unc-25p::snb-1::GFP + lin-15(+)] IV. GFP expression in presynaptic terminals of GABAergic DD and VD motor neurons and RME neurons. Maintain under normal conditions. Reference: Hallan SJ and Jin Y. Nature. 1998 Sep 3;395(6697):78-82.|"Punc-25-SNB-1::GFP(juIs1) IV"|"Reference WBPaper00059613 added based on published strain data identified by Textpresso literature search."|"Supplementary_genotype juIs1 IV [unc-25p::snb-1::gfp + lin-15(+)]"
Proper citation: RRID:WB-STRAIN:WBStrain00005345 Copy
http://www.wormbase.org/db/get?name=WBStrain00005362
Source Database: WormBase (WB)
Affected Genes: WBGene00004457(rpm-1)
Genomic Alteration: WBGene00004457(rpm-1)
Availability: available
Source References: PMID:10839353
Synonyms: rpm-1(ju41) V.
Alternate IDs: WB-STRAIN:CZ1251, CGC_CZ1251
Notes: WT in movement. Abnormal synapses at GABAergic NMJs.
Proper citation: RRID:WB-STRAIN:WBStrain00005362 Copy
http://www.wormbase.org/db/get?name=WBStrain00005361
Source Database: WormBase (WB)
Affected Genes: WBGene00006762(unc-25)|WBGene00023497(lin-15B)|WBGene00023498(lin-15A)
Genomic Alteration: WBGene00006762(unc-25), WBGene00023497(lin-15B), WBGene00023498(lin-15A)
Availability: available
Source References: PMID:37000013, PMID:38253120, PMID:38763511, PMID:39724103
Synonyms: juIs76 II; lin-15B&lin-15A(n765) X.
Alternate IDs: WB-STRAIN:CZ1200, CGC_CZ1200
Notes: expresses GFP in all GABAergic motor neurons|"juIs76 [unc-25p::GFP + lin-15(+)] II."|"No longer available from the CGC"|"No longer available from the CGC catalogue 24/04/2020"
Proper citation: RRID:WB-STRAIN:WBStrain00005361 Copy
http://www.wormbase.org/db/get?name=WBStrain00005359
Source Database: WormBase (WB)
Affected Genes: WBGene00006796(unc-62)
Genomic Alteration: WBGene00006796(unc-62)
Availability: available
Source References: PMID:36617680
Synonyms: unc-62(e917) V.
Alternate IDs: WB-STRAIN:CZ1072, CGC_CZ1072
Notes: Inversion which may serve as a balancer for the center of LG V. Maternal effect lethal allele which results in 57% embryonic arrest, 40% larval arrest, and 3% which survive to be fertile adults with a variety of defects including Egl, Unc and Vab.|"Supplementary_genotype unc-62(e917) V."
Proper citation: RRID:WB-STRAIN:WBStrain00005359 Copy
http://www.wormbase.org/db/get?name=WBStrain00005357
Source Database: WormBase (WB)
Affected Genes: WBGene00006868(vab-1)
Genomic Alteration: WBGene00006868(vab-1)
Availability: available
Source References: EMPTY
Synonyms: vab-1(e2027) II.
Alternate IDs: WB-STRAIN:CZ910, CGC_CZ910
Notes: vab-1 null phenotype. e2027 is a 74 bp deletion allele.
Proper citation: RRID:WB-STRAIN:WBStrain00005357 Copy
http://www.wormbase.org/db/get?name=WBStrain00005355
Source Database: WormBase (WB)
Affected Genes: WBGene00006868(vab-1)|WBGene00023497(lin-15B)|WBGene00023498(lin-15A)
Genomic Alteration: WBGene00006868(vab-1), WBGene00023497(lin-15B), WBGene00023498(lin-15A)
Availability: available
Source References: EMPTY
Synonyms: vab-1(e2027) II; lin-15B&lin-15A(n765) X; juIs24.
Alternate IDs: WB-STRAIN:CZ793, CGC_CZ793
Notes: juIs24 [vab-1::GFP + lin-15(+)]. GFP very faint. Overtly WT.|"Made_by: Inessa Grinberg"
Proper citation: RRID:WB-STRAIN:WBStrain00005355 Copy
http://www.wormbase.org/db/get?name=WBStrain00005371
Source Database: WormBase (WB)
Affected Genes: WBGene00006762(unc-25)|WBGene00006804(unc-71)
Genomic Alteration: WBGene00006762(unc-25), WBGene00006804(unc-71)
Availability: available
Source References: EMPTY
Synonyms: juIs76 II; unc-71(ju160) III.
Alternate IDs: WB-STRAIN:CZ1935, CGC_CZ1935
Notes: juIs76 [unc-25p::GFP + lin-15(+)] II. Unc.|"Made_by: X Huang & Y Jin"
Proper citation: RRID:WB-STRAIN:WBStrain00005371 Copy
Can't find your Organism?
We recommend that you click next to the search bar to check some helpful tips on searches and refine your search firstly. If you want to find a specific organism, it's easier to enter an RRID or a Catalog Number to search. You can refine the search results using Facets on the left side of the search results page. If you are on the table view, you can also search in a specific column by clicking the column title and enter the keywords.
If you still could not find your organism in the search results, please help us by registering it into the system — it's easy. Organisms identifiers are registered through multiple sources depending on the species:
Welcome to the NIF Resources search. From here you can search through a compilation of resources used by NIF and see how data is organized within our community.
You are currently on the Community Resources tab looking through categories and sources that NIF has compiled. You can navigate through those categories from here or change to a different tab to execute your search through. Each tab gives a different perspective on data.
If you have an account on NIF then you can log in from here to get additional features in NIF such as Collections, Saved Searches, and managing Resources.
Here is the search term that is being executed, you can type in anything you want to search for. Some tips to help searching:
You can save any searches you perform for quick access to later from here.
We recognized your search term and included synonyms and inferred terms along side your term to help get the data you are looking for.
If you are logged into NIF you can add data records to your collections to create custom spreadsheets across multiple sources of data.
Here are the sources that were queried against in your search that you can investigate further.
Here are the categories present within NIF that you can filter your data on
Here are the subcategories present within this category that you can filter your data on
If you have any further questions please check out our FAQs Page to ask questions and see our tutorials. Click this button to view this tutorial again.