Searching the RRID Resource Information Network
Are you sure you want to leave this community? Leaving the community will revoke any permissions you have been granted in this community.
Integrated Animals is a virtual database currently indexing available animal strains and mutants from: AGSC (Ambystoma), BCBC (mice), BDSC (flies), European Xenopus Resource Center (frog), The National Xenopus Resource (frog), Xenopus Express (frog), CWRU Cystic Fibrosis Mouse Models (mice), DGGR (flies), FlyBase (flies), IMSR (mice), MGI (mice), MMRRC (mice), NSRRC (pig), RGD (rats), Sperm Stem Cell Libraries for Biological Research (rats), Tetrahymena Stock Center (Tetrahymena), WormBase (worms), XGSC (Xiphophorus), ZFIN (zebrafish), and ZIRC (zebrafish). Note, the IMSR data is linked, but users may need to re-execute the search if the top mouse is not returned properly.
Note: BCBC is no longer in service, so the links may not be functional.
http://www.wormbase.org/db/get?name=WBStrain00004996
Source Database: WormBase (WB)
Affected Genes: WBGene00001072(dpy-10)|WBGene00001076(dpy-17)|WBGene00006744(unc-4)
Genomic Alteration: WBGene00001072(dpy-10), WBGene00001076(dpy-17), WBGene00006744(unc-4)
Availability: available
Source References: EMPTY
Synonyms: unc-4(e120)/mT1 [umnIs52] II; mT1 [dpy-10(e128)]/dpy-17(e164) III.
Alternate IDs: WB-STRAIN:CGC66, CGC_CGC66
Notes: umnIs52 [myo-2p::mKate2 + NeoR, III: 8856215 (intergenic)] II. Heterozygotes are wild-type mKate2+, and segregate wild-type mKate2+, DpyUnc non-mKate2, sterile Dpy mKate2+ mT1 homozygotes, and large numbers of arrested aneuploid embryos. Maintain by picking wild-type mKate2+ and check for correct segregation of progeny to maintain. Derived by insertion of myo-2p::mKate2 transgene into mT1 balancer in parental strain DR1832 using CRISPR/Cas9.
Proper citation: RRID:WB-STRAIN:WBStrain00004996 Copy
http://www.wormbase.org/db/get?name=WBStrain00005002
Source Database: WormBase (WB)
Affected Genes: WBGene00003514(myo-2)|WBGene00004496(rps-27)|WBGene00006789(unc-54)|WBGene00021328(npr-23)
Genomic Alteration: WBGene00003514(myo-2), WBGene00004496(rps-27), WBGene00006789(unc-54), WBGene00021328(npr-23)
Availability: available
Source References: EMPTY
Synonyms: npr-23(umn5[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP]) I.
Alternate IDs: WB-STRAIN:CGC72, CGC_CGC72
Notes: Homozygous viable. Deletion of 280 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Left flanking Sequence: AAGGCGTCATCTGGAGAGAAGAACGAAgtg ; Right flanking sequence: CGGACACTTGTGCTTCACCAACTTGATCGC. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.|"Homozygous viable. Deletion of 280 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break. Left flanking Sequence: AAGGCGTCATCTGGAGAGAAGAACGAAgtg ; Right flanking sequence: CGGACACTTGTGCTTCACCAACTTGATCGC. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation."|"Made_by: RG KO Group"|"Superficially wild-type. CRISPR/Cas9 deletion of npr-23. myo-2p::GFP + NeoR cassette is still present but may be excised using LoxP sites. Left flanking sequence: cccctgcctctggctcccacaaggcgtcatctggagagaagaacgaagtg Right flanking sequence: CGGACACTTGTGCTTCACCAACTTGATCGCGTTGCTCGTATTGGTGCCGG"
Proper citation: RRID:WB-STRAIN:WBStrain00005002 Copy
http://www.wormbase.org/db/get?name=WBStrain00005094
Source Database: WormBase (WB)
Affected Genes: WBGene00006789(unc-54)
Genomic Alteration: WBGene00006789(unc-54)
Availability: available
Source References: PMID:7568134, PMID:9751195, PMID:32966472, PMID:34707479, PMID:36226991, PMID:36653384, PMID:37103980, PMID:37522064, PMID:37113386, PMID:37549461, PMID:38983916, PMID:38991033, PMID:39950089
Synonyms: dvIs2 [Punc-54::human A-beta 3-42; pRF4 (rol-6(su1006]
Alternate IDs: WB-STRAIN:CL2006, CGC_CL2006
Notes: dvIs2 [pCL12(unc-54/human Abeta peptide 1-42 minigene) + rol-6(su1006)]. Temperature-sensitive. Maintain at 15C. Adult onset paralysis and egg-laying deficiency when raised at 20C. A few animals will be paralyzed even at permissive temperatures. Received new stock from CL 8/2005.|"WBStrain provided so WBPaper00059477 paper added based on AFP_Strain data."|"WBStrain provided so WBPaper00062076 paper added based on AFP_Strain data."|"[2020-08-03T18:23:09.013Z WBPerson324] Ressurect Strain: Paper: WBPaper00002289 Genotype: dvIs2 [Punc-54::human A-beta 3-42; pRF4 (rol-6(su1006]"
Proper citation: RRID:WB-STRAIN:WBStrain00005094 Copy
http://www.wormbase.org/db/get?name=WBStrain00005029
Source Database: WormBase (WB)
Affected Genes: WBGene00003738(nid-1)
Genomic Alteration: WBGene00003738(nid-1)
Availability: available
Source References: PMID:38964319
Synonyms: nid-1(cg118) V.
Alternate IDs: WB-STRAIN:CH118, CGC_CH118
Notes: Made_by: J. Kramer|"Parental strain was CH1416 mut-2(r459) I; nid-1(ev608) V. Tc1 excision deletion of nid-1 was identified. In frame deletion, removes amino acids Thr53-Gln693 of NID-1. Homozygous viable and fertile, slightly reduced fertility. mut-2 was removed by outcrossing. nid-1=F54F3.1. Received new stock 1/2004 from Jim Kramer."
Proper citation: RRID:WB-STRAIN:WBStrain00005029 Copy
http://www.wormbase.org/db/get?name=WBStrain00005046
Source Database: WormBase (WB)
Affected Genes: WBGene00003514(myo-2)|WBGene00004897(snb-1)
Genomic Alteration: WBGene00003514(myo-2), WBGene00004897(snb-1)
Availability: unknown
Source References: PMID:21123567, PMID:39724103
Synonyms: [Psnb-1::TDP-43(A315T), Pmyo-2::dsRED]
Alternate IDs: WB-STRAIN:CK426
Notes: Psnb-1::TDP-43 (A315T)|"[2020-05-27T21:32:53.973Z WBPerson324] Ressurect Strain: WBPaper00037845, Genotype: [Psnb-1::TDP-43(A315T), Pmyo-2::dsRED]"|"[2020-05-27T21:32:53.973Z WBPerson324] Update Strain: WBPaper00037845, Genotype: [Psnb-1::TDP-43(A315T), Pmyo-2::dsRED]"
Proper citation: RRID:WB-STRAIN:WBStrain00005046 Copy
http://www.wormbase.org/db/get?name=WBStrain00005040
Source Database: WormBase (WB)
Availability: unknown
Source References: PMID:22611162, PMID:33318982, PMID:37000013
Synonyms: bkIs10 [Paex-3::h4R1NTauV337M; Pmyo-2::gfp]
Alternate IDs: WB-STRAIN:CK10
Notes: bkIs10[Paex-3::h4R1NTauV337M;Pmyo-2::gfp]|"expressing human 1N4R tau with a V337M mutation"|"WBStrain mapped, WBPaper00059548 added based on AFP_Strain data."|"WBStrain mapped, WBPaper00060449 added based on AFP_Strain data."|"WBStrain mapped, WBPaper00060456 added based on AFP_Strain data."|"WBStrain mapped, WBPaper00060486 added based on AFP_Strain data."|"WBStrain mapped, WBPaper00060545 added based on AFP_Strain data."|"WBStrain mapped, WBPaper00060669 added based on AFP_Strain data."|"WBStrain mapped, WBPaper00060692 added based on AFP_Strain data."|"WBStrain mapped, WBPaper00060778 added based on AFP_Strain data."|"WBStrain mapped, WBPaper00060797 added based on AFP_Strain data."|"WBStrain mapped, WBPaper00060840 added based on AFP_Strain data."|"WBStrain mapped, WBPaper00060924 added based on AFP_Strain data."|"WBStrain mapped, WBPaper00060976 added based on AFP_Strain data."|"WBStrain mapped, WBPaper00061045 added based on AFP_Strain data."|"WBStrain mapped, WBPaper00061159 added based on AFP_Strain data."|"WBStrain mapped, WBPaper00061236 added based on AFP_Strain data."|"WBStrain mapped, WBPaper00061385 added based on AFP_Strain data."|"WBStrain mapped, WBPaper00061436 added based on AFP_Strain data."|"WBStrain mapped, WBPaper00061452 added based on AFP_Strain data."|"WBStrain mapped, WBPaper00061495 added based on AFP_Strain data."|"WBStrain mapped, WBPaper00061547 added based on AFP_Strain data."|"WBStrain mapped, WBPaper00061584 added based on AFP_Strain data."|"WBStrain mapped, WBPaper00061641 added based on AFP_Strain data."|"WBStrain mapped, WBPaper00061671 added based on AFP_Strain data."|"WBStrain mapped, WBPaper00061869 added based on AFP_Strain data."|"WBStrain mapped, WBPaper00061871 added based on AFP_Strain data."|"WBStrain mapped, WBPaper00061890 added based on AFP_Strain data."|"WBStrain mapped, WBPaper00061895 added based on AFP_Strain data."|"WBStrain mapped, WBPaper00061902 added based on AFP_Strain data."|"[2020-09-16T20:51:17.431Z WBPerson324] Ressurect Strain: Genotype: bkIs10 [Paex-3::h4R1NTauV337M; Pmyo-2::gfp]"
Proper citation: RRID:WB-STRAIN:WBStrain00005040 Copy
http://www.wormbase.org/db/get?name=WBStrain00005039
Source Database: WormBase (WB)
Affected Genes: WBGene00000961(dgn-1)|WBGene00017221(dgn-3)|WBGene00018943(dgn-2)
Genomic Alteration: WBGene00000961(dgn-1), WBGene00017221(dgn-3), WBGene00018943(dgn-2)
Availability: available
Source References: PMID:38177158
Synonyms: dgn-2(ok209) dgn-3(tm1092) dgn-1(cg121) X; cgEx308.
Alternate IDs: WB-STRAIN:CH1878, CGC_CH1878
Notes: cgEx308 [pJK600/dgn-1(+) + pJK602/dng-1p::GFP + rol-6(su1066)]. Rollers. Pick rollers to maintain. Segregates sterile non-rollers (dgn-2 dgn-3 dgn-1 homozygotes) and fertile rollers (dgn-1 rescued). Rollers can be used to produce cg121/o; cgEx308 males that can mate. Triple mutants resemble dgn-1 single mutants; no overt phenotype caused by dgn-2 dgn-3 mutations.
Proper citation: RRID:WB-STRAIN:WBStrain00005039 Copy
http://www.wormbase.org/db/get?name=WBStrain00005100
Source Database: WormBase (WB)
Availability: available
Source References: PMID:9751195
Synonyms: Punc-54::human Amyloid beta 1-42; mtl-2::gfp
Alternate IDs: WB-STRAIN:CL2120, CGC_CL2120
Notes: dvIs14 [(pCL12) unc-54::beta 1-42 + (pCL26) mtl-2::GFP]. mtl-2::GFP produces strong constitutive intestinal expression of GFP at all developmental stages. Expresses human AB peptide and accumulates B-amyloid fibrils. AB toxicity enhanced at higher temperatures.|"[2020-08-03T20:28:08.764Z WBPerson324] Ressurect Strain: Genotype: Punc-54::human Amyloid beta 1-42; mtl-2::gfp"
Proper citation: RRID:WB-STRAIN:WBStrain00005100 Copy
http://www.wormbase.org/db/get?name=WBStrain00005062
Source Database: WormBase (WB)
Affected Genes: WBGene00004397(rol-6)|WBGene00004879(smg-1)
Genomic Alteration: WBGene00004397(rol-6), WBGene00004879(smg-1)
Availability: available
Source References: PMID:32966472, PMID:37726773, PMID:38983916
Synonyms: smg-1(cc546) I; rol-6(su1006) II.
Alternate IDs: WB-STRAIN:CL802, CGC_CL802
Notes: Rollers. Maintain under normal conditions. Standard control for CL4176; originally used CL1175 as the control, but subsequently it was found that CL1175 can produce some A-Beta. Reference: Fonte V., et al. Mol Neurodegener. 2011 Aug 23;6(1):61. [NOTE: The temperature-sensitive allele cc546 causes an M1957L change in SMG-1. The lesion is an atg>ttg transversion in exon 35. Flanking sequences follow with the mutation site indicated with a capital A: ttggtggtcggttacaaaacgatattcaaga tcactggcagtcatgagtAtggttggatcagttttaggactcggtgatcg acatttggacaatttattg The lesion is detectable via SNP-snip with the mutation causing loss of an MslI site. Primers are for a 323 bp product. Digest with MslI to 86+237 in the wild type, uncut as 323 in the mutant. DJR701(f): CAGTCGTGAGCTTTGGATGCGTGC DJR702(r): TCGGGGATACGCAGATTCTTTCCC. Pedone ... Reiner G3 (2021).]|"Supplementary_genotype [smg-1(cc546) I; rol-6(su1006) II]"|"WBStrain provided so WBPaper00059477 paper added based on AFP_Strain data."
Proper citation: RRID:WB-STRAIN:WBStrain00005062 Copy
http://www.wormbase.org/db/get?name=WBStrain00005190
Source Database: WormBase (WB)
Availability: available
Source References: PMID:36774344, PMID:37118512, PMID:37577954
Synonyms: smIs34.
Alternate IDs: WB-STRAIN:CU1546, CGC_CU1546
Notes: Mutagen:Gamma rays|"smIs34 [ced-1p::ced-1::GFP + rol-6(su1006)]. Maintain under standard conditions. Reference: Zou W, et al., (2009) PLoS Genet. 5(10):e1000679."
Proper citation: RRID:WB-STRAIN:WBStrain00005190 Copy
http://www.wormbase.org/db/get?name=WBStrain00005106
Source Database: WormBase (WB)
Affected Genes: WBGene00004879(smg-1)
Genomic Alteration: WBGene00004879(smg-1)
Availability: available
Source References: PMID:31797327, PMID:32966472, PMID:33466350, PMID:35018947, PMID:37549461, PMID:38274404, PMID:38500791, PMID:38983916, PMID:39212733
Synonyms: EMPTY
Alternate IDs: WB-STRAIN:CL2355, CGC_CL2355
Notes: Associated protein: Human A peptide|"dvIs50 [pCL45 (snb-1::Abeta 1-42::3' UTR(long) + mtl-2::GFP] I. Maintain at 16C. Pan-neuronal expresion of human Abeta peptide. Constitutive intestinal expression of GFP from marker transgene. Strain shows deficits in chemotaxis, associative learning, and thrashing in liquid. Strain also has incomplete sterility due to germline proliferation defects and embryonic lethality. Maintain at 16 C to reduce selection against transgene, although this does not alter the partial sterility. Reference: Wu Y., et al. J Neurosci. 2006 Dec 13;26(50):13102-13. [NOTE: The temperature-sensitive allele cc546 causes an M1957L change in SMG-1. The lesion is an atg>ttg transversion in exon 35. Flanking sequences follow with the mutation site indicated with a capital A: ttggtggtcggttacaaaacgatattcaaga tcactggcagtcatgagtAtggttggatcagttttaggactcggtgatcg acatttggacaatttattg The lesion is detectable via SNP-snip with the mutation causing loss of an MslI site. Primers are for a 323 bp product. Digest with MslI to 86+237 in the wild type, uncut as 323 in the mutant. DJR701(f): CAGTCGTGAGCTTTGGATGCGTGC DJR702(r): TCGGGGATACGCAGATTCTTTCCC. Pedone ... Reiner G3 (2021).]"|"Mutagen:Gamma rays"|"Transgene expression: Inducible pan-neuronal + intestine (marker)"|"[2020-08-03T20:49:03.516Z WBPerson324] Ressurect Strain: Genotype: smg-1(cc546); pCL45 [Psnb-1::human Amyloid beta 1-42::3' UTR (long); Pmtl-2::GFP]"
Proper citation: RRID:WB-STRAIN:WBStrain00005106 Copy
http://www.wormbase.org/db/get?name=WBStrain00005104
Source Database: WormBase (WB)
Availability: available
Source References: PMID:35018947, PMID:37549461, PMID:37239029, PMID:38983916
Synonyms: dvIs37.
Alternate IDs: WB-STRAIN:CL2331, CGC_CL2331
Notes: dvIs37 [myo-3p::GFP::A-Beta (3-42) + rol-6(su1006)]. Maintain at 16C. Roller. Diffuse and aggregated GFP expression in body wall muscle. Low brood size. Sicker at higher temperatures (e.g. 25C). Reference: Link CD, et al. (2008) Neurobiology of Disease,32(3):420-5.|"expresses the human A3-42 peptide fused to green fluorescent protein (GFP) in its body-wall muscle cells"|"Mutagen:Gamma radiation"
Proper citation: RRID:WB-STRAIN:WBStrain00005104 Copy
http://www.wormbase.org/db/get?name=WBStrain00005102
Source Database: WormBase (WB)
Affected Genes: WBGene00001752(gst-4)
Genomic Alteration: WBGene00001752(gst-4)
Availability: available
Source References: PMID:12757851, PMID:29956725, PMID:31409866, PMID:31432005, PMID:31510078, PMID:31717869, PMID:31735670, PMID:32294300, PMID:32600387, PMID:33008901, PMID:32163353, PMID:33471780, PMID:33789349, PMID:33809299, PMID:33883621, PMID:34505574, PMID:35602005, PMID:36791646, PMID:37099597, PMID:37416472, PMID:37427543, PMID:37488107, PMID:37549461, PMID:37606250, PMID:37726773, PMID:37751046, PMID:37902464, PMID:37910615, PMID:38632209, PMID:38799567, PMID:38754743, PMID:38889876, PMID:38983916, PMID:38991033, PMID:39169052, PMID:39164296, PMID:39264947, PMID:39097626, PMID:39420966, PMID:39561954, PMID:39560153
Synonyms: dvIs19 [(pAF15)gst-4p::GFP::NLS] III.
Alternate IDs: WB-STRAIN:CL2166, CGC_CL2166
Notes: dvIs19 [(pAF15)gst-4p::GFP::NLS] III. Oxidative stress-inducible GFP.|"Reference WBPaper00054805 added based on published strain data identified by Textpresso literature search."|"Reference WBPaper00057197 added based on published strain data identified by Textpresso literature search."|"Reference WBPaper00057259 added based on published strain data identified by Textpresso literature search."|"Reference WBPaper00058621 added based on published strain data identified by Textpresso literature search."|"Reference WBPaper00058851 added based on published strain data identified by Textpresso literature search."|"Supplementary_genotype (dvIs19[pAF15(gst-4::GFP::NLS)])"|"Supplementary_genotype dvIs19 [(pAF15)gst-4p::GFP::NLS] III"|"Supplementary_genotype dvIs19[(pAF15)gst-4p::GFP::NLS]"|"Supplementary_genotype gst-4::GFP dvIs19 [(pAF15)gst-4p::GFP::NLS] III"|"Supplementary_genotype gst-4p::GFP"|"WBStrain mapped, WBPaper00059548 added based on AFP_Strain data."|"WBStrain mapped, WBPaper00060449 added based on AFP_Strain data."|"WBStrain mapped, WBPaper00060456 added based on AFP_Strain data."|"WBStrain mapped, WBPaper00060486 added based on AFP_Strain data."|"WBStrain mapped, WBPaper00060545 added based on AFP_Strain data."|"WBStrain mapped, WBPaper00060669 added based on AFP_Strain data."|"WBStrain mapped, WBPaper00060692 added based on AFP_Strain data."|"WBStrain mapped, WBPaper00060778 added based on AFP_Strain data."|"WBStrain mapped, WBPaper00060797 added based on AFP_Strain data."|"WBStrain mapped, WBPaper00060840 added based on AFP_Strain data."|"WBStrain mapped, WBPaper00060896 added based on AFP_Strain data."|"WBStrain mapped, WBPaper00060924 added based on AFP_Strain data."|"WBStrain mapped, WBPaper00060976 added based on AFP_Strain data."|"WBStrain mapped, WBPaper00061045 added based on AFP_Strain data."|"WBStrain mapped, WBPaper00061159 added based on AFP_Strain data."|"WBStrain mapped, WBPaper00061220 added based on AFP_Strain data."|"WBStrain mapped, WBPaper00061236 added based on AFP_Strain data."|"WBStrain mapped, WBPaper00061385 added based on AFP_Strain data."|"WBStrain mapped, WBPaper00061436 added based on AFP_Strain data."|"WBStrain mapped, WBPaper00061452 added based on AFP_Strain data."|"WBStrain mapped, WBPaper00061495 added based on AFP_Strain data."|"WBStrain mapped, WBPaper00061547 added based on AFP_Strain data."|"WBStrain mapped, WBPaper00061584 added based on AFP_Strain data."|"WBStrain mapped, WBPaper00061641 added based on AFP_Strain data."|"WBStrain mapped, WBPaper00061671 added based on AFP_Strain data."|"WBStrain mapped, WBPaper00061869 added based on AFP_Strain data."|"WBStrain mapped, WBPaper00061871 added based on AFP_Strain data."|"WBStrain mapped, WBPaper00061890 added based on AFP_Strain data."|"WBStrain mapped, WBPaper00061895 added based on AFP_Strain data."|"WBStrain mapped, WBPaper00061902 added based on AFP_Strain data."|"WBStrain provided so WBPaper00059545 paper added based on AFP_Strain data."|"WBStrain provided so WBPaper00060797 paper added based on AFP_Strain data."
Proper citation: RRID:WB-STRAIN:WBStrain00005102 Copy
http://www.wormbase.org/db/get?name=WBStrain00005119
Source Database: WormBase (WB)
Affected Genes: WBGene00006843(unc-119)
Genomic Alteration: WBGene00006843(unc-119)
Availability: available
Source References: PMID:37039075, PMID:37118512
Synonyms: unc-119(ed3) III; knuSi221.
Alternate IDs: WB-STRAIN:COP262, CGC_COP262
Notes: fib-1 translational marker|"knuSi221 [fib-1p::fib-1(genomic)::eGFP::fib-1 3' UTR + unc-119(+)]. Single copy insertion. fib-1 promoter, genomic sequence, and 3'UTR was inserted into pCFJ151 (ttTi5606) targeting vector and inserted into ttTi5605. Allen AK, Nesmith JE, and A Golden. 2014 G3:4(12)2329-43."|"Made_by: Knudra Transgenics"
Proper citation: RRID:WB-STRAIN:WBStrain00005119 Copy
http://www.wormbase.org/db/get?name=WBStrain00005114
Source Database: WormBase (WB)
Availability: available
Source References: PMID:37957360, PMID:39212733
Synonyms: dvIs62 X.
Alternate IDs: WB-STRAIN:CL6049, CGC_CL6049
Notes: Associated protein: Human TDP-43|"dvIs62 [snb-1p::hTDP-43/3' long UTR + mtl-2p::GFP] X. Temperature-sensitive. Maintain at 16 to minimize selection against transgene. Uncoordinated from hatching; phenotype is stronger at higher temperatures. Intestinal GFP expression. Reference: Ash PE, et al. Hum Mol Genet. 2010 Aug 15;19(16):3206-18."|"Mutagen:UV/TMP"|"Supplementary_genotype dvIs62 [snb-1p::hTDP-43/3'long UTR + mtl-2p::GFP] X"|"Transgene expression: Inducible pan-neuronal + intestine (marker)"
Proper citation: RRID:WB-STRAIN:WBStrain00005114 Copy
http://www.wormbase.org/db/get?name=WBStrain00005145
Source Database: WormBase (WB)
Affected Genes: WBGene00001864(him-5)|WBGene00004857(sma-3)
Genomic Alteration: WBGene00001864(him-5), WBGene00004857(sma-3)
Availability: available
Source References: EMPTY
Synonyms: sma-3(wk30) III; him-5(e1490) V; qcEx24.
Alternate IDs: WB-STRAIN:CS119, CGC_CS119
Notes: qcEx24 [GFP::sma-3 + rol-6(su1006)]. Rollers. Pick rollers to maintain. Array rescues body size phenotype. Reference: Wang J, Tokarz R, Savage-Dunn C. Development. 2002 Nov;129(21):4989-98.
Proper citation: RRID:WB-STRAIN:WBStrain00005145 Copy
http://www.wormbase.org/db/get?name=WBStrain00005138
Source Database: WormBase (WB)
Availability: unknown
Source References: PMID:22723984
Synonyms: nlg-1 (ok259) X; crrEx7 [pPD95.77 (Pnlg-1::NLGN1-R453C); pDD04NeoR(Pmyo-2::GFP)].
Alternate IDs: WB-STRAIN:CRR107
Notes: EMPTY
Proper citation: RRID:WB-STRAIN:WBStrain00005138 Copy
http://www.wormbase.org/db/get?name=WBStrain00005147
Source Database: WormBase (WB)
Affected Genes: WBGene00001864(him-5)|WBGene00004857(sma-3)
Genomic Alteration: WBGene00001864(him-5), WBGene00004857(sma-3)
Availability: available
Source References: EMPTY
Synonyms: sma-3(wk30) III; him-5(e1490) V; qcEx53.
Alternate IDs: WB-STRAIN:CS211, CGC_CS211
Notes: qcEx53 [vha-6p::GFP::sma-3 + rol-6(su1006)]. Sma. Rollers. Pick rollers to maintain. Reference: Wang J, Tokarz R, Savage-Dunn C. Development. 2002 Nov;129(21):4989-98.
Proper citation: RRID:WB-STRAIN:WBStrain00005147 Copy
http://www.wormbase.org/db/get?name=WBStrain00005178
Source Database: WormBase (WB)
Affected Genes: WBGene00003026(lin-41)
Genomic Alteration: WBGene00003026(lin-41)
Availability: available
Source References: PMID:37541249
Synonyms: lin-41(ma104) I.
Alternate IDs: WB-STRAIN:CT8, CGC_CT8
Notes: Dpy. Precocious heterochronic. Reduced brood size. There may be a linked Dpy mutation in this strain.|"mutator TR679"|"Supplementary_genotype lin-4 (ma104)"
Proper citation: RRID:WB-STRAIN:WBStrain00005178 Copy
http://www.wormbase.org/db/get?name=WBStrain00005186
Source Database: WormBase (WB)
Availability: available
Source References: EMPTY
Synonyms: zaIs2.
Alternate IDs: WB-STRAIN:CT21, CGC_CT21
Notes: zaIs2 [lin-14::GFP + rol-6(su1006)]. Rollers, though Rol is not completely penetrant, Reference: Olsson-Carter K, Slack FJ. PLoS Genet. 2010 Aug 5;6(8). pii: e1001054.
Proper citation: RRID:WB-STRAIN:WBStrain00005186 Copy
Can't find your Organism?
We recommend that you click next to the search bar to check some helpful tips on searches and refine your search firstly. If you want to find a specific organism, it's easier to enter an RRID or a Catalog Number to search. You can refine the search results using Facets on the left side of the search results page. If you are on the table view, you can also search in a specific column by clicking the column title and enter the keywords.
If you still could not find your organism in the search results, please help us by registering it into the system — it's easy. Organisms identifiers are registered through multiple sources depending on the species:
Welcome to the NIF Resources search. From here you can search through a compilation of resources used by NIF and see how data is organized within our community.
You are currently on the Community Resources tab looking through categories and sources that NIF has compiled. You can navigate through those categories from here or change to a different tab to execute your search through. Each tab gives a different perspective on data.
If you have an account on NIF then you can log in from here to get additional features in NIF such as Collections, Saved Searches, and managing Resources.
Here is the search term that is being executed, you can type in anything you want to search for. Some tips to help searching:
You can save any searches you perform for quick access to later from here.
We recognized your search term and included synonyms and inferred terms along side your term to help get the data you are looking for.
If you are logged into NIF you can add data records to your collections to create custom spreadsheets across multiple sources of data.
Here are the sources that were queried against in your search that you can investigate further.
Here are the categories present within NIF that you can filter your data on
Here are the subcategories present within this category that you can filter your data on
If you have any further questions please check out our FAQs Page to ask questions and see our tutorials. Click this button to view this tutorial again.
Welcome to the Neuroscience Information Framework Project, designed to serve the biomedical research community. NIF maintains the largest searchable collection of neuroscience data, the largest catalog of biomedical resources, and the largest ontology for neuroscience on the web. We welcome all feedback and suggestions and are actively looking for resource providers to make their resources accessible through NIF. Learn about the tools available to help you share your data and discover a dynamic inventory of Web-based neuroscience resources.
