Are you sure you want to leave this community? Leaving the community will revoke any permissions you have been granted in this community.
Integrated Animals is a virtual database currently indexing available animal strains and mutants from: AGSC (Ambystoma), BCBC (mice), BDSC (flies), European Xenopus Resource Center (frog), The National Xenopus Resource (frog), Xenopus Express (frog), CWRU Cystic Fibrosis Mouse Models (mice), DGGR (flies), FlyBase (flies), IMSR (mice), MGI (mice), MMRRC (mice), NSRRC (pig), RGD (rats), Sperm Stem Cell Libraries for Biological Research (rats), Tetrahymena Stock Center (Tetrahymena), WormBase (worms), XGSC (Xiphophorus), ZFIN (zebrafish), and ZIRC (zebrafish). Note, the IMSR data is linked, but users may need to re-execute the search if the top mouse is not returned properly.
Note: BCBC is no longer in service, so the links may not be functional.
http://www.wormbase.org/db/get?name=WBStrain00054784
Source Database: WormBase (WB)
Affected Genes: WBGene00001569(meg-3)|WBGene00003994(pgl-3)
Genomic Alteration: WBGene00001569(meg-3), WBGene00003994(pgl-3)
Availability: unknown
Source References: EMPTY
Synonyms: pgl-3(ax4517[pgl-3::3xFLAG]) V; meg-3(ax3054[meg-3::meGFP]) X.
Notes: 3xFlag tag inserted at C-terminus of endogenous pgl-3 locus. Inserted into parental strain JH3503 meg-3(ax3054[meg-3::meGFP]). Reference: Ouyang JPT, et al. Nature Cell Biology 2022 (24)11291140. DOI: 10.1038/s41556-022-00940-w.|"Made_by: Brennan Danlasky"
Proper citation: RRID:WB-STRAIN:WBStrain00054784 Copy
http://www.wormbase.org/db/get?name=WBStrain00054781
Source Database: WormBase (WB)
Affected Genes: WBGene00003795(npp-9)
Genomic Alteration: WBGene00003795(npp-9)
Availability: unknown
Source References: PMID:37254647
Synonyms: bqSi189 II; npp-9(ax4540[mNeonGreen::npp-9]) III.
Notes: bqSi189 [lmn-1p::mCherry::his-58::pie-1 3'utr] II. mNeonGreen is inserted at the N-terminus of the endogenous npp-9 locus. bqSi189 is a single-copy MosSCI insertion into ttTi5605. Reference: Thomas et al. 2022. Cytoplasmic nucleoporin foci are stress-sensitive, non-essential condensates in C. elegans|"Made_by: Basma Taleb Ismail"
Proper citation: RRID:WB-STRAIN:WBStrain00054781 Copy
http://www.wormbase.org/db/get?name=WBStrain00054823
Source Database: WormBase (WB)
Affected Genes: WBGene00006449(alg-4)
Genomic Alteration: WBGene00006449(alg-4)
Availability: unknown
Source References: PMID:38967024
Synonyms: alg-4(tor143[GFP::3xFLAG::alg-4]) III.
Notes: GFP and 3xFLAG tags inserted into endgonenous alg-4 locus. Reference: Charlesworth AG, et al. Nucleic Acids Res. 2021 Sep 7;49(15):8836-8865. PMID: 34329465
Proper citation: RRID:WB-STRAIN:WBStrain00054823 Copy
http://www.wormbase.org/db/get?name=WBStrain00054825
Source Database: WormBase (WB)
Affected Genes: WBGene00019971(ergo-1)
Genomic Alteration: WBGene00019971(ergo-1)
Availability: unknown
Source References: EMPTY
Synonyms: ergo-1(tor147[GFP::3xFLAG::ergo-1a]) V.
Notes: GFP and 3xFLAG tags inserted into endgonenous ergo-1 locus; specifically tags a-isoform. Reference: Seroussi U, et al. bioRxiv 2022.08.08.502013; doi: https:
Proper citation: RRID:WB-STRAIN:WBStrain00054825 Copy
http://www.wormbase.org/db/get?name=WBStrain00054820
Source Database: WormBase (WB)
Affected Genes: WBGene00000105(alg-1)
Genomic Alteration: WBGene00000105(alg-1)
Availability: unknown
Source References: EMPTY
Synonyms: alg-1(tor137[GFP::3xFLAG::alg-1b]) X.
Notes: GFP and 3xFLAG tags inserted into endgonenous alg-1 locus; specifically tags b-isoform. Reference: Seroussi U, et al. bioRxiv 2022.08.08.502013; doi: https:
Proper citation: RRID:WB-STRAIN:WBStrain00054820 Copy
http://www.wormbase.org/db/get?name=WBStrain00054786
Source Database: WormBase (WB)
Affected Genes: WBGene00003797(npp-11)
Genomic Alteration: WBGene00003797(npp-11)
Availability: unknown
Source References: PMID:37254647
Synonyms: npp-11(ax4547[npp-11::wrmScarlet]) I.
Notes: Made_by: Basma Taleb Ismail|"wrmScarlet is inserted at the C-terminus of the endogenous npp-11 locus. Reference: Thomas et al. 2022. Cytoplasmic nucleoporin foci are stress-sensitive, non-essential condensates in C. elegans"
Proper citation: RRID:WB-STRAIN:WBStrain00054786 Copy
http://www.wormbase.org/db/get?name=WBStrain00054822
Source Database: WormBase (WB)
Affected Genes: WBGene00011910(alg-3)
Genomic Alteration: WBGene00011910(alg-3)
Availability: unknown
Source References: EMPTY
Synonyms: alg-3(tor141[GFP::3xFLAG::alg-3]) IV.
Notes: GFP and 3xFLAG tags inserted into endgonenous alg-3 locus. Reference: Charlesworth AG, et al. Nucleic Acids Res. 2021 Sep 7;49(15):8836-8865. PMID: 34329465
Proper citation: RRID:WB-STRAIN:WBStrain00054822 Copy
http://www.wormbase.org/db/get?name=WBStrain00054788
Source Database: WormBase (WB)
Affected Genes: WBGene00001067(dpy-5)|WBGene00001595(gld-1)|WBGene00006751(unc-11)
Genomic Alteration: WBGene00001067(dpy-5), WBGene00001595(gld-1), WBGene00006751(unc-11)
Availability: unknown
Source References: EMPTY
Synonyms: gld-1(q343)/unc-11(e47) dpy-5(e61) I
Notes: Heterozygotes are WT and segregate WT, Dpy Uncs, and homozygous q343 (make small abnormal oocytes. Pick WT and check for correct segregation of progeny to maintain. Reference: Francis R, et al. Genetics. 1995 Feb; 139(2): 579606. doi: 10.1093/genetics/139.2.579 PMID: 7713419.
Proper citation: RRID:WB-STRAIN:WBStrain00054788 Copy
http://www.wormbase.org/db/get?name=WBStrain00054821
Source Database: WormBase (WB)
Affected Genes: WBGene00000106(alg-2)
Genomic Alteration: WBGene00000106(alg-2)
Availability: unknown
Source References: EMPTY
Synonyms: alg-2(tor139[GFP::3xFLAG::alg-2b]) II.
Notes: GFP and 3xFLAG tags inserted into endgonenous alg-2 locus; specifically tags b-isoform. Reference: Seroussi U, et al. bioRxiv 2022.08.08.502013; doi: https:
Proper citation: RRID:WB-STRAIN:WBStrain00054821 Copy
http://www.wormbase.org/db/get?name=WBStrain00054828
Source Database: WormBase (WB)
Affected Genes: WBGene00011061(wago-1)
Genomic Alteration: WBGene00011061(wago-1)
Availability: unknown
Source References: EMPTY
Synonyms: wago-1(tor113[GFP::3xFLAG::wago-1]) I.
Notes: GFP and 3xFLAG tags inserted into endgonenous wago-1 locus. Reference: Seroussi U, et al. bioRxiv 2022.08.08.502013; doi: https:
Proper citation: RRID:WB-STRAIN:WBStrain00054828 Copy
http://www.wormbase.org/db/get?name=WBStrain00054772
Source Database: WormBase (WB)
Affected Genes: WBGene00010492(meg-1)
Genomic Alteration: WBGene00010492(meg-1)
Availability: unknown
Source References: EMPTY
Synonyms: meg-1(ax4534[meg-1::gfp]) X.
Notes: GFP tag inserted at C-terminus of the endogenous meg-1 locus by CRISPR. Reference: Cassani M & Seydoux G. Development 2022 Nov 1;149(21):dev200920. doi: 10.1242/dev.200920. PMID: 36196602.
Proper citation: RRID:WB-STRAIN:WBStrain00054772 Copy
http://www.wormbase.org/db/get?name=WBStrain00054774
Source Database: WormBase (WB)
Affected Genes: WBGene00001569(meg-3)|WBGene00003916(par-1)
Genomic Alteration: WBGene00001569(meg-3), WBGene00003916(par-1)
Availability: unknown
Source References: EMPTY
Synonyms: par-1(ax4202[par-1(T983A)]) V/nT1[qIs51] (IV;V); meg-3(ax3054[meg-3::meGFP]) X.
Notes: meGFP inserted between P121 and V122 of endogenous MEG-3. qIs51 [myo-2p::GFP + pes-10p::GFP + F22B7.9p::GFP]. Heterozygotes are wild-type GFP+ and segregate non-GFP par-1 homozygotes (viable, lay dead embryos), wild-type GFP+ heterozygotes, and arrested nT1[qIs51] aneuploids. Pick wild-type GFP+ and check for correct segregation of progeny to maintain. Replacement of threonine 983 with alanine eliminates PAR-1 asymmetry. Reference: Folkman AW & Seydoux G. Development. 2019 Mar 25;146(6):dev171116. doi: 10.1242/dev.171116. PMID: 30814118
Proper citation: RRID:WB-STRAIN:WBStrain00054774 Copy
http://www.wormbase.org/db/get?name=WBStrain00054770
Source Database: WormBase (WB)
Affected Genes: WBGene00000265(brd-1)|WBGene00002027(hsr-9)
Genomic Alteration: WBGene00000265(brd-1), WBGene00002027(hsr-9)
Availability: unknown
Source References: EMPTY
Synonyms: hsr-9(xoe17) I; brd-1(xoe18) III.
Notes: Emb. Reference: Hariri S, et al. (2023). 53bp1 mutation enhances brca1 and bard1 embryonic lethality in C. elegans. microPublication Biology. 10.17912/micropub.biology.000934. PMID: 37581122.
Proper citation: RRID:WB-STRAIN:WBStrain00054770 Copy
http://www.wormbase.org/db/get?name=WBStrain00054775
Source Database: WormBase (WB)
Affected Genes: WBGene00001569(meg-3)|WBGene00003916(par-1)
Genomic Alteration: WBGene00001569(meg-3), WBGene00003916(par-1)
Availability: unknown
Source References: EMPTY
Synonyms: par-1(ax4208[meGFP::delta-KA1]) V/nT1[qIs51] (IV;V).
Notes: meGFP inserted between P121 and V122 of endogenous MEG-3. qIs51 [myo-2p::GFP + pes-10p::GFP + F22B7.9p::GFP]. Heterozygotes are wild-type GFP+ and segregate non-GFP par-1 homozygotes (viable, lay viable progeny that are completely sterile), wild-type GFP+ heterozygotes, and arrested nT1[qIs51] aneuploids. Pick wild-type GFP+ and check for correct segregation of progeny to maintain. par-1(ax4208) removes the KA1 domain from a GFP-tagged version of PAR-1. Reference: Folkman AW & Seydoux G. Development. 2019 Mar 25;146(6):dev171116. doi: 10.1242/dev.171116. PMID: 30814118
Proper citation: RRID:WB-STRAIN:WBStrain00054775 Copy
http://www.wormbase.org/db/get?name=WBStrain00054778
Source Database: WormBase (WB)
Affected Genes: WBGene00003800(npp-14)
Genomic Alteration: WBGene00003800(npp-14)
Availability: unknown
Source References: PMID:37254647
Synonyms: npp-14(ax4543) I.
Notes: ax4523 is a deletion residues 24-1387 of the npp-14 coding region. Reference: Thomas et al. 2022. Cytoplasmic nucleoporin foci are stress-sensitive, non-essential condensates in C. elegans
Proper citation: RRID:WB-STRAIN:WBStrain00054778 Copy
http://www.wormbase.org/db/get?name=WBStrain00054811
Source Database: WormBase (WB)
Affected Genes: WBGene00000168(apx-1)
Genomic Alteration: WBGene00000168(apx-1)
Availability: unknown
Source References: EMPTY
Synonyms: apx-1(q1148[apx-1::3xV5]) V.
Notes: 3xV5 tag inserted at C-terminus of endogenous apx-1 locus. APX-1 guide: GACTCGTCATCTGCTGCCATCGG. APX-1 3xV5 repair with mutation (197 nt): CCTATGGCAGCAGATGACGAGTCGTCGTTTCGAGTCGGTAAGCCTATCCCTAACCCTCTCCTCGGTCTAGATAGTACTGGAAAGCCAATCCCAAACCCACTCCTCGGACTTGATAGCACCGGTAAGCCTATCCCTAACCCACTCCTCGGACTTGATAGCACCTAAACAACAGCTCGACGACGAGATTTACAATAATT.|"CRISPR/Cas9 gene editing was used to insert a 3xV5 tag inserted at the C-terminus of the endogenous apx-1 locus immediately upstream of STOP codon. Animals are fertile and express low levels of APX-1 V5 in adult DTCs."
Proper citation: RRID:WB-STRAIN:WBStrain00054811 Copy
http://www.wormbase.org/db/get?name=WBStrain00054810
Source Database: WormBase (WB)
Affected Genes: WBGene00003785(nos-3)
Genomic Alteration: WBGene00003785(nos-3)
Availability: unknown
Source References: EMPTY
Synonyms: nos-3(q902) II; qSi380 IV.
Notes: Made_by: Jon Doenier|"qSi380 [mex-5p::eGFP::3xOLASS::linker::his-58::MODC pest::3xboxb::tbb-2 3'UTR::SL2 trans-splice site::mCherry::3xV5::linker::his-58::MODC pest::mutant 3xboxb::tbb-2 3'utr::tbb-1 intergenic region] IV. Worms are fertile at 20C. Improved tethering assay for use in the C. elegans germline. GFP reporter mRNA is under control of a germline-expressed mex-5 promoter and has three boxB stem-loops in its 3'UTR. The RNA-binding protein (RBP) is tagged with lamda-N. The nascent transcript driven by mex-5 promoter is resolved by trans-splicing into two mRNAs that encode distinct reporters. The GFP reporter RNA has three functional boxB stem-loops in its 3'UTR; the mCherry reporter 3'UTR has three mutated boxB stem-loops that do not bind lamda-N and therefore provides an internal control. Addition of an OLLAS tag to GFP and a V5 tag to mCherry enables sensitive immunostaining and immunoblotting. Reference: Doenier J, et al. RNA. 2021 Jun;(6)643-652. PMID: 33727224."
Proper citation: RRID:WB-STRAIN:WBStrain00054810 Copy
http://www.wormbase.org/db/get?name=WBStrain00054819
Source Database: WormBase (WB)
Affected Genes: WBGene00018921(sago-2)
Genomic Alteration: WBGene00018921(sago-2)
Availability: unknown
Source References: EMPTY
Synonyms: sago-2(tor135) I.
Notes: Null allele of sago-2; detectable by PCR/restriction digest. Reference: Seroussi U, et al. bioRxiv 2022.08.08.502013; doi: https:
Proper citation: RRID:WB-STRAIN:WBStrain00054819 Copy
http://www.wormbase.org/db/get?name=WBStrain00054881
Source Database: WormBase (WB)
Affected Genes: WBGene00006843(unc-119)
Genomic Alteration: WBGene00006843(unc-119)
Availability: unknown
Source References: EMPTY
Synonyms: unc-119(ed9) III; irSi24 IV.
Notes: irSi24 [pept-1::mCherry::H2B + Cbr-unc-119(+)] IV. Single-copy MosSCI insertion of pept-1 reporter into cxTi10882 site in LG IV. mCherry fluorescence exclusively in intestinal nuclei from the end of embryonic development through adulthood. Generated in N2 background. Reference: Maduro MF, et al. Dev Biol 2015 Aug 1;404(1):66-79. doi: 10.1016/j.ydbio.2015.04.025, PMID:25959238.
Proper citation: RRID:WB-STRAIN:WBStrain00054881 Copy
http://www.wormbase.org/db/get?name=WBStrain00054880
Source Database: WormBase (WB)
Affected Genes: WBGene00006925(vit-1)|WBGene00006926(vit-2)
Genomic Alteration: WBGene00006925(vit-1), WBGene00006926(vit-2)
Availability: unknown
Source References: EMPTY
Synonyms: vit-2(ok3211) vit-1(hq532) X.
Notes: hq532 is a CRISPR-engineered knockout of vit-1 in vit-2(ok3211) background removing 8 bp from the third exon of vit-1: WT sequence AAAGCATTGAGAAGGAGTCCACAACTGTTGTCCGCGGACGCCGTATCCAAACCGGAATCACG mutated to AAAGCATTGAGAAGGAGTCCACAAC--------GCGGACGCCGTATCCAAACCGGAATCACG. For genotyping, the following primers will produce ~800 bp DNA fragment that can be sequenced. Forward primer: TACCAACGTGTTGCTATCGTTTGCTC. Reverse primer: TTGCTCGAAGAGTGGGGTGAACATTCTC. Strain does not express vit-1 or vit-2. Reference: Zhai C, et al. bioRxiv 2022.06.27.497668; doi: https:|"Made_by: Chao Zhai"
Proper citation: RRID:WB-STRAIN:WBStrain00054880 Copy
Can't find your Organism?
We recommend that you click next to the search bar to check some helpful tips on searches and refine your search firstly. If you want to find a specific organism, it's easier to enter an RRID or a Catalog Number to search. You can refine the search results using Facets on the left side of the search results page. If you are on the table view, you can also search in a specific column by clicking the column title and enter the keywords.
If you still could not find your organism in the search results, please help us by registering it into the system — it's easy. Organisms identifiers are registered through multiple sources depending on the species:
Welcome to the NIF Resources search. From here you can search through a compilation of resources used by NIF and see how data is organized within our community.
You are currently on the Community Resources tab looking through categories and sources that NIF has compiled. You can navigate through those categories from here or change to a different tab to execute your search through. Each tab gives a different perspective on data.
If you have an account on NIF then you can log in from here to get additional features in NIF such as Collections, Saved Searches, and managing Resources.
Here is the search term that is being executed, you can type in anything you want to search for. Some tips to help searching:
You can save any searches you perform for quick access to later from here.
We recognized your search term and included synonyms and inferred terms along side your term to help get the data you are looking for.
If you are logged into NIF you can add data records to your collections to create custom spreadsheets across multiple sources of data.
Here are the sources that were queried against in your search that you can investigate further.
Here are the categories present within NIF that you can filter your data on
Here are the subcategories present within this category that you can filter your data on
If you have any further questions please check out our FAQs Page to ask questions and see our tutorials. Click this button to view this tutorial again.