Are you sure you want to leave this community? Leaving the community will revoke any permissions you have been granted in this community.
Integrated Animals is a virtual database currently indexing available animal strains and mutants from: AGSC (Ambystoma), BCBC (mice), BDSC (flies), European Xenopus Resource Center (frog), The National Xenopus Resource (frog), Xenopus Express (frog), CWRU Cystic Fibrosis Mouse Models (mice), DGGR (flies), FlyBase (flies), IMSR (mice), MGI (mice), MMRRC (mice), NSRRC (pig), RGD (rats), Sperm Stem Cell Libraries for Biological Research (rats), Tetrahymena Stock Center (Tetrahymena), WormBase (worms), XGSC (Xiphophorus), ZFIN (zebrafish), and ZIRC (zebrafish). Note, the IMSR data is linked, but users may need to re-execute the search if the top mouse is not returned properly.
Note: BCBC is no longer in service, so the links may not be functional.
| Organism Name | Proper Citation | Species | Synonyms |
Notes |
Phenotype | Affected Gene | ||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
|
F20D1.3(ve805[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP]) X. Resource Report Resource Website |
RRID:WB-STRAIN:WBStrain00055453 | Caenorhabditis elegans | F20D1.3(ve805[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP]) X. | Homozygous viable. Deletion of 986 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Left flanking Sequence: CATATGCAGCAACTTAAGAtttttttttCA ; Right flanking sequence: TATCCAACTCAGAAGAAGAAGAAGAGCTGC. sgRNA #1: GATTTGGCGCATCAACTGCA; sgRNA #2: GTAGGCATTCTGTCCATCAG. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.|"Made_by: RG KO Group" | WBGene00003514(myo-2)|WBGene00004496(rps-27)|WBGene00006789(unc-54) | WBGene00003514(myo-2), WBGene00004496(rps-27), WBGene00006789(unc-54) | WB-STRAIN:WBStrain00055453 | WormBase (WB) | WB | unknown | 2026-08-01 10:24:46 | 0 | ||||
|
C15H9.4(ve808[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP])/tmC30 [ubc-17(tmIs1243)] X. Resource Report Resource Website |
RRID:WB-STRAIN:WBStrain00055456 | Caenorhabditis elegans | C15H9.4(ve808[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP])/tmC30 [ubc-17(tmIs1243)] X. | Made_by: RG KO Group|"tmIs1243 [myo-2p::mCherry, X: ubc-17] X. Homozygous animals may be sensitive to starvation (grotty, low brood size). Deletion of 1634 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Heterozygotes are wild-type GFP+ mCherry+, and segregate wild-type GFP+ mCherry+, wild-type GFP+ non-mCherry (ve808 homozygotes), and Lon Mec non-GFP mCherry+ (tmC30 homozygotes). Maintain by picking wild-type GFP+ mCherry+.Left flanking Sequence: TACTATATTCTGTTATTCCAAAATGCGTTT ; Right flanking sequence: ATAATGTGAACAGCACGCAAAACGGAACAA. sgRNA #1: GTTCCAGATGACAACAGACT; sgRNA #2: TGTCAAATCAGCTTTTTCGG. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation." | WBGene00003514(myo-2)|WBGene00004496(rps-27)|WBGene00006712(ubc-17)|WBGene00006789(unc-54) | WBGene00003514(myo-2), WBGene00004496(rps-27), WBGene00006712(ubc-17), WBGene00006789(unc-54) | WB-STRAIN:WBStrain00055456 | WormBase (WB) | WB | unknown | 2026-08-01 10:24:46 | 0 | ||||
|
F27D9.2(ve804[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP]) X. Resource Report Resource Website |
RRID:WB-STRAIN:WBStrain00055452 | Caenorhabditis elegans | F27D9.2(ve804[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP]) X. | Homozygous viable. Deletion of 3038 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Left flanking Sequence: CAGAAATGGGAGGAGACACGATTGAAACAG ; Right flanking sequence: TGGATTATATTGCGTGTGAGAATGGTTCCA. sgRNA #1: GAGAGAAAATTCTAGATGAC; sgRNA #2: TGGTAGTCCTTATTAGTGCG. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.|"Made_by: RG KO Group" | WBGene00003514(myo-2)|WBGene00004496(rps-27)|WBGene00006789(unc-54) | WBGene00003514(myo-2), WBGene00004496(rps-27), WBGene00006789(unc-54) | WB-STRAIN:WBStrain00055452 | WormBase (WB) | WB | unknown | 2026-08-01 10:24:42 | 0 | ||||
|
trmt-10A(ve803[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP]) IV. Resource Report Resource Website |
RRID:WB-STRAIN:WBStrain00055451 | Caenorhabditis elegans | trmt-10A(ve803[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP]) IV. | F25H8.1. Homozygous viable. Deletion of 1172 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Left flanking Sequence: gggtgtaattttaaaatatgaaaatgaTTA ; Right flanking sequence: atttagaatatattttttaatgttttcaaa. sgRNA #1: ATTTATTTTAGGAGAGCCCG; sgRNA #2: atcattttggcatctttaag. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.|"Made_by: RG KO Group" | WBGene00003514(myo-2)|WBGene00004496(rps-27)|WBGene00006789(unc-54) | WBGene00003514(myo-2), WBGene00004496(rps-27), WBGene00006789(unc-54) | WB-STRAIN:WBStrain00055451 | WormBase (WB) | WB | unknown | 2026-08-01 10:24:43 | 0 | ||||
|
C28F5.4(ve810[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP]) II. Resource Report Resource Website |
RRID:WB-STRAIN:WBStrain00055458 | Caenorhabditis elegans | C28F5.4(ve810[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP]) II. | Homozygous viable. Deletion of 2762 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Left flanking Sequence: TCCTCTTTCGTGATTCTTTTTGAAATGCCA ; Right flanking sequence: TTCCTAAGAAGAGCATATGCTCGCAGAAGT. sgRNA #1: GGACGCAATAAAGAAGTGCG; sgRNA #2: CTGCCAAATATCCGTCAGAG. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.|"Made_by: RG KO Group" | WBGene00003514(myo-2)|WBGene00004496(rps-27)|WBGene00006789(unc-54) | WBGene00003514(myo-2), WBGene00004496(rps-27), WBGene00006789(unc-54) | WB-STRAIN:WBStrain00055458 | WormBase (WB) | WB | unknown | 2026-08-01 10:24:42 | 0 | ||||
|
fars-2(ve811[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP])/sC4(s2172) [dpy-21(e428)] V. Resource Report Resource Website |
RRID:WB-STRAIN:WBStrain00055459 | Caenorhabditis elegans | fars-2(ve811[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP])/sC4(s2172) [dpy-21(e428)] V. | Homozygous Ste, Pvl, Unc. Deletion of 3213 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Heterozygotes are wild-type dim GFP+, and segregate wild-type dim GFP+, bright GFP+ Ste, Pvl, and Unc animals (ve811 homozygotes) and arrested non-GFP (stage unknown, some uncharacterized non-GFP hermaphrodites develop into fertile adults) (sC4 homozygotes). Maintain by picking wild-type dim GFP+.Left flanking Sequence: ggtttttcagtgctcttcgtattacCTCCT ; Right flanking sequence: TTCGTCTTTCGAGTAGAGCCGAACACCTTC. sgRNA #3: TGAAAGAGCACTTACCAAGG; sgRNA #4: CTACTCGGCAAAAAGCCGGA. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.|"Made_by: RG KO Group" | WBGene00001080(dpy-21)|WBGene00003514(myo-2)|WBGene00004496(rps-27)|WBGene00006789(unc-54)|WBGene00013361(fars-2) | WBGene00001080(dpy-21), WBGene00003514(myo-2), WBGene00004496(rps-27), WBGene00006789(unc-54), WBGene00013361(fars-2) | WB-STRAIN:WBStrain00055459 | WormBase (WB) | WB | unknown | 2026-08-01 10:24:46 | 0 | ||||
|
ugt-20(ve793[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP]) IV. Resource Report Resource Website |
RRID:WB-STRAIN:WBStrain00055442 | Caenorhabditis elegans | ugt-20(ve793[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP]) IV. | Homozygous viable. Deletion of 2672 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Left flanking Sequence: TAATCAGAATAAAAATTGCGATAATGTCCA ; Right flanking sequence: tggtgtcaagatttttttgtacagagagac. sgRNA #1: ATTCGTTGAGTACTTCTTTT; sgRNA #2: atcctaacagttctgcccag. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.|"Made_by: RG KO Group" | WBGene00003514(myo-2)|WBGene00004496(rps-27)|WBGene00006789(unc-54)|WBGene00019516(ugt-20) | WBGene00003514(myo-2), WBGene00004496(rps-27), WBGene00006789(unc-54), WBGene00019516(ugt-20) | WB-STRAIN:WBStrain00055442 | WormBase (WB) | WB | unknown | 2026-08-01 10:24:42 | 0 | ||||
|
+/nT1[umnIs49] IV; F25H9.6(ve797[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP])/nT1 V. Resource Report Resource Website |
RRID:WB-STRAIN:WBStrain00055445 | Caenorhabditis elegans | +/nT1[umnIs49] IV; F25H9.6(ve797[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP])/nT1 V. | Made_by: RG KO Group|"umnIs49 [myo-2p::mKate2 + NeoR, V: 1005689 (intergenic)] IV. Homozygous Sterile. Deletion of 1068 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Heterozygotes are wild-type GFP+ mKate2+, and segregate wild-type GFP+ mKate2+, GFP+ non-mKate sterile adults (ve797 homozygotes), Vul non-GFP mKate2+ (nT1 homozygotes) and dead eggs (aneuploids). Maintain by picking wild-type GFP+ mKate2+. Maintain by picking wild-type GFP+ mKate2+. Left flanking Sequence: aatagaagaaaaatatgatattgtCTACCC ; Right flanking sequence: AATTCGTCGGACATgttaaccgaacaagtt. sgRNA #1: AGGCAGTTCGCATCCAATGC; sgRNA #2: ATCAGTGAAAAGGCACAAGT. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation." | WBGene00003514(myo-2)|WBGene00004496(rps-27)|WBGene00006789(unc-54) | WBGene00003514(myo-2), WBGene00004496(rps-27), WBGene00006789(unc-54) | WB-STRAIN:WBStrain00055445 | WormBase (WB) | WB | unknown | 2026-08-01 10:24:42 | 0 | ||||
|
T20D3.6(ve796[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP]) IV. Resource Report Resource Website |
RRID:WB-STRAIN:WBStrain00055444 | Caenorhabditis elegans | T20D3.6(ve796[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP]) IV. | Homozygous viable. Deletion of 526 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Left flanking Sequence: tagaacattttatgaatcaaaagTTAAGCA ; Right flanking sequence: CGGAAGTCATGTGGCTCGGCGTTCATtttt. sgRNA #1: GAATTATTCTGAGGAACCGC; sgRNA #2: TTATATGCGCTTTGTGATCA. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.|"Made_by: RG KO Group" | WBGene00003514(myo-2)|WBGene00004496(rps-27)|WBGene00006789(unc-54) | WBGene00003514(myo-2), WBGene00004496(rps-27), WBGene00006789(unc-54) | WB-STRAIN:WBStrain00055444 | WormBase (WB) | WB | unknown | 2026-08-01 10:24:46 | 0 | ||||
|
cox-18(ve791[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP])/tmC25[unc-5(tm9708)] IV. Resource Report Resource Website |
RRID:WB-STRAIN:WBStrain00055440 | Caenorhabditis elegans | cox-18(ve791[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP])/tmC25[unc-5(tm9708)] IV. | Homozygous Ste, Pvl. Deletion of 2404 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Heterozygotes are wild-type GFP+, and segregate wild-type GFP+ heterozygotes, GFP+ Ste Pvl adults (ve791 homozygotes), and Unc animals (tmC25 [unc-5(tm9708)] homozygotes). Maintain by picking wild-type GFP+. Left flanking Sequence: gaaattcgaaatctacgcaaaatttcagcg ; Right flanking sequence: agggcaaaaaaaaaattgcttaagcctgag. sgRNA #1: accaaatcacgaaaactaga; sgRNA #2: tgaccccaaccagtttctga. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.|"Homozygous Ste, Pvl. Deletion of 2404 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Heterozygotes are wild-type GFP+, and segregate wild-type GFP+, GFP+ Ste, Pvl adults (ve791 homozygotes) and Unc animals (tmC25 [unc-5(tm9708)] homozygotes). Maintain by picking wild-type GFP+. Left flanking Sequence: gaaattcgaaatctacgcaaaatttcagcg ; Right flanking sequence: agggcaaaaaaaaaattgcttaagcctgag. sgRNA #1: accaaatcacgaaaactaga; sgRNA #2: tgaccccaaccagtttctga. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation."|"Made_by: RG KO Group" | WBGene00003514(myo-2)|WBGene00004496(rps-27)|WBGene00006745(unc-5)|WBGene00006789(unc-54)|WBGene00021932(cox-18) | WBGene00003514(myo-2), WBGene00004496(rps-27), WBGene00006745(unc-5), WBGene00006789(unc-54), WBGene00021932(cox-18) | WB-STRAIN:WBStrain00055440 | WormBase (WB) | WB | unknown | 2026-08-01 10:24:42 | 0 | ||||
|
wbp-2(ve799[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP])/mnC1 [dpy-10(e128) unc-52(e444) umnIs37] II. Resource Report Resource Website |
RRID:WB-STRAIN:WBStrain00055447 | Caenorhabditis elegans | wbp-2(ve799[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP])/mnC1 [dpy-10(e128) unc-52(e444) umnIs37] II. | Made_by: RG KO Group|"umnIs37 [myo-2p::mKate2 + NeoR, II: 11755713 (intergenic)] II. Homozygous sterile. Deletion of 1296 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Heterozygotes are wild-type GFP+ mKate2+ and segregate wild-type GFP+ mKate2+ heterozygotes, GFP+ non-mKate2 sterile adults (ve799 homozygotes) and paralysed DpyUnc non-GFP mKate2+ (mnC1 homozygotes). Maintain by picking wild-type GFP+ mKate2+. Left flanking Sequence: taccacttgtttaatttatatttagATGTC ; Right flanking sequence: TAActtgtaaatttaacaacaaaaaatgac. sgRNA #1: CATCAACACGGCGAACACGC; sgRNA #2: ATTTCTTCGCCTCAATCCAT. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation." | WBGene00001072(dpy-10)|WBGene00003514(myo-2)|WBGene00004496(rps-27)|WBGene00006787(unc-52)|WBGene00006789(unc-54)|WBGene00008404(wbp-2) | WBGene00001072(dpy-10), WBGene00003514(myo-2), WBGene00004496(rps-27), WBGene00006787(unc-52), WBGene00006789(unc-54), WBGene00008404(wbp-2) | WB-STRAIN:WBStrain00055447 | WormBase (WB) | WB | unknown | 2026-08-01 10:24:46 | 0 | ||||
|
M05D6.5(ve798[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP]) II. Resource Report Resource Website |
RRID:WB-STRAIN:WBStrain00055446 | Caenorhabditis elegans | M05D6.5(ve798[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP]) II. | Homozygous viable. Deletion of 1412 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Left flanking Sequence: gagagaaagtatacaatttatTCATTTCTG ; Right flanking sequence: ACGGAACATGCCCATtttgtgtgaagagag. sgRNA #1: GTGCTCCTCATCTTCATACG; sgRNA #2: ACAGCTTTCATGAACGTCGC. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.|"Made_by: RG KO Group" | WBGene00003514(myo-2)|WBGene00004496(rps-27)|WBGene00006789(unc-54) | WBGene00003514(myo-2), WBGene00004496(rps-27), WBGene00006789(unc-54) | WB-STRAIN:WBStrain00055446 | WormBase (WB) | WB | unknown | 2026-08-01 10:24:42 | 0 | ||||
|
vps-25(ve801[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP])/hIn1 [unc-54(h1040)] I. Resource Report Resource Website |
RRID:WB-STRAIN:WBStrain00055449 | Caenorhabditis elegans | vps-25(ve801[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP])/hIn1 [unc-54(h1040)] I. | Late larval arrest. Deletion of 1316 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Heterozygotes are wild-type GFP+, and segregate wild-type GFP+, GFP+clear arrested L4 larvae (ve801 homozygotes) and non-GFP Unc animals (hIn1[unc-54(h1040)] homozygotes). Maintain by picking wild-type GFP+. Left flanking Sequence: CAAATAAATTTAACGCCTTCATTATCTCCA ; Right flanking sequence: CGGCctgaaaaatgcgtaattccctgaaaa. sgRNA #1: GCTCAATTGATGAATATCGG; sgRNA #2: TGACACCGTCGGTTGAGAGG. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.|"Made_by: RG KO Group" | WBGene00003514(myo-2)|WBGene00004496(rps-27)|WBGene00006789(unc-54)|WBGene00012193(vps-25) | WBGene00003514(myo-2), WBGene00004496(rps-27), WBGene00006789(unc-54), WBGene00012193(vps-25) | WB-STRAIN:WBStrain00055449 | WormBase (WB) | WB | unknown | 2026-08-01 10:24:42 | 0 | ||||
|
+/mT1 [umnIs52] II; trmt-10C.2(ve789[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP])/mT1 [dpy-10(e128)] III. Resource Report Resource Website |
RRID:WB-STRAIN:WBStrain00055438 | Caenorhabditis elegans | +/mT1 [umnIs52] II; trmt-10C.2(ve789[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP])/mT1 [dpy-10(e128)] III. | Made_by: RG KO Group|"umnIs52 [myo-2p::mKate2 + NeoR, III: 8856215 (intergenic)] II. C56G2.3. Homozygotes arrest as late larvae or become sterile adults. Deletion of 1669 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Heterozygotes are wild-type GFP+ mKate2+, and segregate wild-type GFP+ mKate2+ heterozygotes, GFP+ non-mKate2 sterile adults (ve789 homozygotes), sterile Dpy non-GFP mKate2+ (mT1 homozygotes), and dead eggs (aneuploids). Maintain by picking wild-type GFP+ mKate2+ and check for correct segregation of progeny. Left flanking Sequence: acttctggactttaattcccttacctatta ; Right flanking sequence: aggtgaagctgagcgtggcaactcacttca. sgRNA #1: cccagtgacgatattgagat; sgRNA #2: tttctctagctctttcagac. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation."|"umnIs52 [myo-2p::mKate2 + NeoR, III: 8856215 (intergenic)] II. Homozygotes arrest as late larvae or become sterile adults. Deletion of 1669 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Heterozygotes are wild-type GFP+ mKate2+, and segregate wild-type GFP+ mKate2+ heterozygotes, GFP+ non-mKate2 sterile adults (ve789 homozygotes), sterile Dpy non-GFP mKate2+ (mT1 homozygotes), and dead eggs (aneuploids). Maintain by picking wild-type GFP+ mKate2+ and check for correct segregation of progeny. Left flanking Sequence: acttctggactttaattcccttacctatta ; Right flanking sequence: aggtgaagctgagcgtggcaactcacttca. sgRNA #1: cccagtgacgatattgagat; sgRNA #2: tttctctagctctttcagac. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation." | WBGene00001072(dpy-10)|WBGene00003514(myo-2)|WBGene00004496(rps-27)|WBGene00006789(unc-54) | WBGene00001072(dpy-10), WBGene00003514(myo-2), WBGene00004496(rps-27), WBGene00006789(unc-54) | WB-STRAIN:WBStrain00055438 | WormBase (WB) | WB | unknown | 2026-08-01 10:24:46 | 0 | ||||
|
F41C3.8(ve788[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP]) II. Resource Report Resource Website |
RRID:WB-STRAIN:WBStrain00055437 | Caenorhabditis elegans | F41C3.8(ve788[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP]) II. | Homozygous viable. Deletion of 2556 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Left flanking Sequence: caatttcactggtctatttctatttcgcca ; Right flanking sequence: GGGATCCGTTAAAGAATCTTCATCACAAGA. sgRNA #1: ttgtcacacgctcatacgtg; sgRNA #2: GTTATTTGCCTACTCATAGT. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.|"Made_by: RG KO Group" | WBGene00003514(myo-2)|WBGene00004496(rps-27)|WBGene00006789(unc-54) | WBGene00003514(myo-2), WBGene00004496(rps-27), WBGene00006789(unc-54) | WB-STRAIN:WBStrain00055437 | WormBase (WB) | WB | unknown | 2026-08-01 10:24:42 | 0 | ||||
|
ttc-17(ve851[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP]) V. Resource Report Resource Website |
RRID:WB-STRAIN:WBStrain00055494 | Caenorhabditis elegans | ttc-17(ve851[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP]) V. | Homozygous viable. Deletion of 4149 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Left flanking Sequence: ATCGCGTGGAATACGACTGCAATCCGACAG ; Right flanking sequence: GGAAAGAATTCGAGTTTTAATTGTTGAATT. ttc-17 sgRNA #1: TTTCCACACGTCTTTCACCG; ttc-17 sgRNA #1: CAGCATGGCAATATATCGTG. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.|"Made_by: RG KO Group" | WBGene00003514(myo-2)|WBGene00004496(rps-27)|WBGene00006789(unc-54)|WBGene00020553(ttc-17) | WBGene00003514(myo-2), WBGene00004496(rps-27), WBGene00006789(unc-54), WBGene00020553(ttc-17) | WB-STRAIN:WBStrain00055494 | WormBase (WB) | WB | unknown | 2026-08-01 10:24:43 | 0 | ||||
|
F41E6.5(ve853[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP]) V. Resource Report Resource Website |
RRID:WB-STRAIN:WBStrain00055496 | Caenorhabditis elegans | F41E6.5(ve853[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP]) V. | Homozygous viable. Deletion of 1278 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Left flanking Sequence:ATTCAAACTCTCTACTGTAAAATGACTCCG ; Right flanking sequence: GGGACTTGCCACATCGGTATTTTCTTTCTT. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.|"Made_by: RG KO Group" | WBGene00003514(myo-2)|WBGene00004496(rps-27)|WBGene00006789(unc-54) | WBGene00003514(myo-2), WBGene00004496(rps-27), WBGene00006789(unc-54) | WB-STRAIN:WBStrain00055496 | WormBase (WB) | WB | unknown | 2026-08-01 10:24:44 | 0 | ||||
|
asp-5(ve852[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP]) V. Resource Report Resource Website |
RRID:WB-STRAIN:WBStrain00055495 | Caenorhabditis elegans | asp-5(ve852[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP]) V. | Homozygous viable. Deletion of 1561 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Left flanking Sequence: TCACGACCATTTTTCCAGGTATGAAGACCA ; Right flanking sequence: GGGATTCGCCAACTCCCTTCAGGCCAATTA. asp-5 sgRNA #1: GGCAACTAGTGCTACGAAAG; asp-5 sgRNA #2: GATATTGGAGGACAACGTAT. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.|"Made_by: RG KO Group" | WBGene00000218(asp-5)|WBGene00003514(myo-2)|WBGene00004496(rps-27)|WBGene00006789(unc-54) | WBGene00000218(asp-5), WBGene00003514(myo-2), WBGene00004496(rps-27), WBGene00006789(unc-54) | WB-STRAIN:WBStrain00055495 | WormBase (WB) | WB | unknown | 2026-08-01 10:24:47 | 0 | ||||
|
'+/mT1 [umnIs52] II; famh-136(hd7024[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP])/mT1 [dpy-10(e128)] III. Resource Report Resource Website |
RRID:WB-STRAIN:WBStrain00055534 | Caenorhabditis elegans | '+/mT1 [umnIs52] II; famh-136(hd7024[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP])/mT1 [dpy-10(e128)] III. | umnIs52 [myo-2p::mKate2 + NeoR, III: 8856215 (intergenic)] II. Pick wild-type GFP+ and mKate2+ animals to maintain. Apparent homozygous lethal deletion balanced over mT1. Heterozygotes are wild-type GFP+ mKate2+, and segregate wild-type GFP+ mKate2+, GFP+ non-mKate2 (hd7024 homozygotes), sterile Dpy non-GFP mKate2+ mT1 homozygotes, and large numbers of arrested aneuploid embryos. Derived from parental strains VH7027 and CGC66. hd7024 is a 542 bp deletion with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break. Left flanking sequence: TTTTGAGCTTTAGCTATCTTCCTTTATCCT; Right flanking sequence: ATCACAGGTGTGAAGATTTATTAAATTTTA. sgRNA #1: ATGAATGACGCAAGAATTAA; sgRNA #2: TCTGAATACTTATTGACATC. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation. | WBGene00001072(dpy-10)|WBGene00003514(myo-2)|WBGene00004496(rps-27)|WBGene00006789(unc-54)|WBGene00014022(famh-136) | WBGene00001072(dpy-10), WBGene00003514(myo-2), WBGene00004496(rps-27), WBGene00006789(unc-54), WBGene00014022(famh-136) | WB-STRAIN:WBStrain00055534 | WormBase (WB) | WB | unknown | 2026-08-01 10:24:47 | 0 | ||||
|
Y57G11C.1147(ve844[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP])/nT1 [umnIs49] IV; +/nT1 V. Resource Report Resource Website |
RRID:WB-STRAIN:WBStrain00055487 | Caenorhabditis elegans | Y57G11C.1147(ve844[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP])/nT1 [umnIs49] IV; +/nT1 V. | Made_by: RG KO Group|"umnIs49 [myo-2p::mKate2 + NeoR, V: 1005689 (intergenic)] IV. Homozygous Mel. Deletion of 489 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Heterozygotes are wild-type GFP+ mKate2+, and segregate wild-type GFP+ mKate2+, GFP+ non-mKate that give dead eggs (ve844 homozygotes), Vul non-GFP mKate2+ (nT1 homozygotes) and dead eggs (aneuploids). Maintain by picking wild-type GFP+ mKate2+. Maintain by picking wild-type GFP+ mKate2+. Left flanking Sequence: ACGGACGACTCTTCCGGCAGTTGCAGACAT; Right flanking sequence: TCAACGCTGAAAAGCTGAAAAACGGTGAAG. Y57G11C.1147 sgRNA #1: GAGTATCTCCTTTGGTGACA; Y57G11C.1147 sgRNA #2: TCAGCGTTGAATGCACGCTT. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation." | WBGene00003514(myo-2)|WBGene00004496(rps-27)|WBGene00006789(unc-54) | WBGene00003514(myo-2), WBGene00004496(rps-27), WBGene00006789(unc-54) | WB-STRAIN:WBStrain00055487 | WormBase (WB) | WB | unknown | 2026-08-01 10:24:43 | 0 |
Can't find your Organism?
We recommend that you click next to the search bar to check some helpful tips on searches and refine your search firstly. If you want to find a specific organism, it's easier to enter an RRID or a Catalog Number to search. You can refine the search results using Facets on the left side of the search results page. If you are on the table view, you can also search in a specific column by clicking the column title and enter the keywords.
If you still could not find your organism in the search results, please help us by registering it into the system — it's easy. Organisms identifiers are registered through multiple sources depending on the species:
Welcome to the NIF Resources search. From here you can search through a compilation of resources used by NIF and see how data is organized within our community.
You are currently on the Community Resources tab looking through categories and sources that NIF has compiled. You can navigate through those categories from here or change to a different tab to execute your search through. Each tab gives a different perspective on data.
If you have an account on NIF then you can log in from here to get additional features in NIF such as Collections, Saved Searches, and managing Resources.
Here is the search term that is being executed, you can type in anything you want to search for. Some tips to help searching:
If you are logged into NIF you can add data records to your collections to create custom spreadsheets across multiple sources of data.
Here are the facets that you can filter the data by.
If you have any further questions please check out our FAQs Page to ask questions and see our tutorials. Click this button to view this tutorial again.