Searching the RRID Resource Information Network
Are you sure you want to leave this community? Leaving the community will revoke any permissions you have been granted in this community.
| Plasmid Name | Proper Citation | Insert Name | Organism | Bacterial Resistance | Defining Citation |
Comments |
||||
|---|---|---|---|---|---|---|---|---|---|---|
|
IP04838 Resource Report Resource Website |
RRID:DGRC_1381486 | Drosophila melanogaster | PMID:16326860 | BDGP iPCR Collection | 2026-08-29 04:59:56 | 0 | ||||
|
IP16479 Resource Report Resource Website |
RRID:DGRC_1604016 | Drosophila melanogaster | PMID:16326860 | BDGP iPCR Collection | 2026-08-29 04:56:16 | 0 | ||||
|
LentiCRISPRv2-sgCD20 Resource Report Resource Website |
RRID:Addgene_209749 | MS4A1 | Homo sapiens | Ampicillin | PMID:37683180 | Can be used to knockout the human CD20 gene, MS4A1. After which, pCDH-V1-rCD20-BSD, pCDH-V2-rCD20-BSD or pCDH-V3-rCD20-BSD can be used to reconstitute CD20 expression with either variants 1, 2 or 3 mRNA isoforms of CD20. | Backbone Marker:Feng Zhang (Addgene plasmid # 52961); Backbone Size:14873; Vector Backbone:lentiCRISPR v2; Vector Types:Lentiviral; Bacterial Resistance:Ampicillin | 2026-09-12 02:39:39 | 0 | |
|
LentiCRISPRv2-sgCTRL Resource Report Resource Website |
RRID:Addgene_209750 | Cas9 | Synthetic | Ampicillin | PMID:37683180 | Backbone Marker:Feng Zhang (Addgene plasmid # 52961); Backbone Size:14873; Vector Backbone:lentiCRISPR v2; Vector Types:Lentiviral; Bacterial Resistance:Ampicillin | 2026-09-12 02:39:39 | 0 | ||
|
pRH3176 Resource Report Resource Website |
RRID:Addgene_210178 | YIp ADE2-LEU2 pTDH3::aro7-G141S-GFP::tADH1 | Saccharomyces cerevisiae | Ampicillin | PMID:37729018 | Vector Backbone:pRH3022; Vector Types:Yeast Expression; Bacterial Resistance:Ampicillin | G141S | 2026-09-12 02:39:39 | 0 | |
|
pCDH-kz-CD20-Puro Resource Report Resource Website |
RRID:Addgene_209759 | MS4A1 | Homo sapiens | Ampicillin | PMID:37683180 | Backbone Marker:Systembio; Backbone Size:7133; Vector Backbone:pCDH-CMV-MCS; Vector Types:Lentiviral; Bacterial Resistance:Ampicillin | 2026-09-12 02:39:39 | 0 | ||
|
pCDH-V2-CD20-Puro Resource Report Resource Website |
RRID:Addgene_209756 | MS4A1 | Homo sapiens | Ampicillin | PMID:37683180 | Backbone Marker:Systembio; Backbone Size:7133; Vector Backbone:pCDH-CMV-MCS; Vector Types:Lentiviral; Bacterial Resistance:Ampicillin | 2026-09-12 02:39:39 | 0 | ||
|
pCDH-V3-CD20-Puro Resource Report Resource Website |
RRID:Addgene_209757 | MS4A1 | Homo sapiens | Ampicillin | PMID:37683180 | Backbone Marker:Systembio; Backbone Size:7133; Vector Backbone:pCDH-CMV-MCS; Vector Types:Lentiviral; Bacterial Resistance:Ampicillin | 2026-09-12 02:39:39 | 0 | ||
|
Myc-RILPL1 Resource Report Resource Website |
RRID:Addgene_201470 | RILPL1 | Homo sapiens | Ampicillin | PMID:38091401 | Please visit https://www.biorxiv.org/content/10.1101/2023.06.07.544051v3 for bioRxiv preprint. | Backbone Size:5428; Vector Backbone:pcDNA3.1; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin | 2026-09-12 02:39:38 | 0 | |
|
pCDH-V1-rCD20-BSD Resource Report Resource Website |
RRID:Addgene_209752 | MS4A1 | Homo sapiens | Ampicillin | PMID:37683180 | Lentiviral transfer plasmid to express the 5'-UTR and CDS of the human CD20 gene, MS4A1. Specifically, the variant 1 mRNA isoform of CD20. The "CCTGGGGGGTCTTCTGATGATCC" sequence within the CDS of MS4A1 was altered with synonymous substitutions to "GTTGGGCGGACTACTTATGATTC" to avoid recognition by the gRNA from LentiCRISPRv2-sgCD20. This allows for the rescue of CD20 expression after LentiCRISPRv2-sgCD20 vector-mediated knockout. | Backbone Size:7456; Vector Backbone:pCDH-IRES-BSD; Vector Types:Lentiviral; Bacterial Resistance:Ampicillin | The CCTGGGGGGTCTTCTGATGATCC sequence within the CDS of CD20 was mutated to GTTGGGCGGACTACTTATGATTC to confer resistance to the CD20-targeting gRNA from the LentiCRISPRv2-sgCD20 vector. | 2026-09-12 02:39:39 | 0 |
|
pCDH-V2-rCD20-BSD Resource Report Resource Website |
RRID:Addgene_209753 | MS4A1 | Homo sapiens | Ampicillin | PMID:37683180 | Lentiviral transfer plasmid to express the 5'-UTR and CDS of the human CD20 gene, MS4A1. Specifically, the variant 2 mRNA isoform of CD20. The "CCTGGGGGGTCTTCTGATGATCC" sequence within the CDS of MS4A1 was altered with synonymous substitutions to "GTTGGGCGGACTACTTATGATTC" to avoid recognition by the gRNA from LentiCRISPRv2-sgCD20. This allows for the rescue of CD20 expression after LentiCRISPRv2-sgCD20 vector-mediated knockout. | Backbone Size:7456; Vector Backbone:pCDH-IRES-BSD; Vector Types:Lentiviral; Bacterial Resistance:Ampicillin | The CCTGGGGGGTCTTCTGATGATCC sequence within the CDS of CD20 was mutated to GTTGGGCGGACTACTTATGATTC to confer resistance to the CD20-targeting gRNA from the LentiCRISPRv2-sgCD20 vector. | 2026-09-12 02:39:39 | 0 |
|
pCDH-V3-rCD20-BSD Resource Report Resource Website |
RRID:Addgene_209754 | MS4A1 | Homo sapiens | Ampicillin | PMID:37683180 | Lentiviral transfer plasmid to express the 5'-UTR and CDS of the human CD20 gene, MS4A1. Specifically, the variant 3 mRNA isoform of CD20. The "CCTGGGGGGTCTTCTGATGATCC" sequence within the CDS of MS4A1 was altered with synonymous substitutions to "GTTGGGCGGACTACTTATGATTC" to avoid recognition by the gRNA from LentiCRISPRv2-sgCD20. This allows for the rescue of CD20 expression after LentiCRISPRv2-sgCD20 vector-mediated knockout. | Backbone Size:7456; Vector Backbone:pCDH-IRES-BSD; Vector Types:Lentiviral; Bacterial Resistance:Ampicillin | The CCTGGGGGGTCTTCTGATGATCC sequence within the CDS of CD20 was mutated to GTTGGGCGGACTACTTATGATTC to confer resistance to the CD20-targeting gRNA from the LentiCRISPRv2-sgCD20 vector. | 2026-09-12 02:39:39 | 0 |
|
pRH3186 Resource Report Resource Website |
RRID:Addgene_210181 | YIp ADE2-LEU2 pTDH3::lys1-W353G-GFP::tADH1 | Saccharomyces cerevisiae | Ampicillin | PMID:37729018 | Vector Backbone:pRH3022; Vector Types:Yeast Expression; Bacterial Resistance:Ampicillin | W353G | 2026-09-12 02:39:39 | 0 | |
|
pHS1801 Resource Report Resource Website |
RRID:Addgene_205966 | Cas8-HNH proteins and CRISPR array | Selenomonas sp. isolate RGIG9219 Water_deer_Rumen (MAG), JAGBLH010000220 | Chloramphenicol | PMID:37995242 | Vector Backbone:pACYCDuet-1; Vector Types:Bacterial Expression; Bacterial Resistance:Chloramphenicol | 2026-09-12 02:39:38 | 0 | ||
|
pLIX403_RPS2_APOBEC_HA_P2A_mRuby_Capture1 Resource Report Resource Website |
RRID:Addgene_194703 | RPS2 | Homo sapiens | Ampicillin | PMID:33963355 | Backbone Size:10863; Vector Backbone:pLIX403_Capture1_APOBEC_HA_P2A_mRuby; Vector Types:Mammalian Expression, Lentiviral; Bacterial Resistance:Ampicillin | 2026-09-12 02:39:38 | 0 | ||
|
Salsa-BC12-P1A12 Resource Report Resource Website |
RRID:Addgene_202853 | EGFP/BC12 | Synthetic | Ampicillin | PMID:37321219 | Please note: Plasmid contains a M234K mutation in EGFP. This mutation is not expected to affect plasmid function. | Vector Backbone:pCER206; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin | 2026-09-12 02:39:38 | 0 | |
|
pHS1182 Resource Report Resource Website |
RRID:Addgene_205964 | DinG HNH crRNA | Sulfitobacter sp. JL08, NZ_CP025815 | Kanamycin | PMID:37995242 | Vector Backbone:pColADuet-1; Vector Types:Bacterial Expression; Bacterial Resistance:Kanamycin | 2026-09-12 02:39:38 | 0 | ||
|
pHS1232 Resource Report Resource Website |
RRID:Addgene_205969 | Cas5-HNH proteins and CRISPR array | Candidatus Cloacimonetes bacterium (MAG), MWEE01000013 | Chloramphenicol | PMID:37995242 | Vector Backbone:pACYCDuet-1; Vector Types:Bacterial Expression; Bacterial Resistance:Chloramphenicol | 2026-09-12 02:39:38 | 0 | ||
|
Lenti-EFS-NTID194-GSQ-PMLiva3MAS-P2A-BLAST Resource Report Resource Website |
RRID:Addgene_208039 | PML (isoform IVa; 3MAS) | Homo sapiens | Ampicillin | PMID:34795231 | Control for PMLiva SUMO-ID experiments; 3MAS mutant lacks major SUMOylation sites and SIM domain. | Vector Backbone:Derived from Addgene ID# 52962 (Zhang Lab).; Vector Types:Lentiviral; Bacterial Resistance:Ampicillin | 3MAS mutant: K65R, K160R and K490R; mutated SIM | 2026-09-12 02:39:38 | 0 |
|
TRIPZ-CTID195-GSQ-SUMO1nc-PURO Resource Report Resource Website |
RRID:Addgene_208035 | SUMO1nc | Homo sapiens | Ampicillin | PMID:34795231 | Lentiviral packaging of TRIPZ is more efficient with TAT expression (e.g using pcDNA1-TatHIV Addgene ID: 138478) and 2nd generation gag/pol/env combination (e.g. using PSPAX2 Addgene ID: 12260 and pMD2.G Addgene ID: 12259); SUMO1nc is excisable using EcoR1-Mlu1. | Backbone Marker:Open Biosystems; Vector Backbone:TRIPZ; Vector Types:Lentiviral; Bacterial Resistance:Ampicillin | Q94P Mutation near C-terminus suppresses cleavage by SENPs/DUBs | 2026-09-12 02:39:38 | 0 |
Can't find your Plasmid?
We recommend that you click next to the search bar to check some helpful tips on searches and refine your search firstly. If you want to find a specific plasmid, it's easier to enter an RRID or an Addgene Catalog Number to search. You can refine the search results using Facets on the left side of the search results page. If you are on the table view, you can also search in a specific column by clicking the column title and enter the keywords.
If you still could not find your plasmid in the search results, please help us by registering it into the system — it's easy. Register it with Addgene.
Welcome to the NIF Resources search. From here you can search through a compilation of resources used by NIF and see how data is organized within our community.
You are currently on the Community Resources tab looking through categories and sources that NIF has compiled. You can navigate through those categories from here or change to a different tab to execute your search through. Each tab gives a different perspective on data.
If you have an account on NIF then you can log in from here to get additional features in NIF such as Collections, Saved Searches, and managing Resources.
Here is the search term that is being executed, you can type in anything you want to search for. Some tips to help searching:
If you are logged into NIF you can add data records to your collections to create custom spreadsheets across multiple sources of data.
Here are the facets that you can filter the data by.
If you have any further questions please check out our FAQs Page to ask questions and see our tutorials. Click this button to view this tutorial again.
Welcome to the Neuroscience Information Framework Project, designed to serve the biomedical research community. NIF maintains the largest searchable collection of neuroscience data, the largest catalog of biomedical resources, and the largest ontology for neuroscience on the web. We welcome all feedback and suggestions and are actively looking for resource providers to make their resources accessible through NIF. Learn about the tools available to help you share your data and discover a dynamic inventory of Web-based neuroscience resources.
