Searching the RRID Resource Information Network

Our searching services are busy right now. Please try again later

  • Register
X
Forgot Password

If you have forgotten your password you can enter your email here and get a temporary password sent to your email.

X

Leaving Community

Are you sure you want to leave this community? Leaving the community will revoke any permissions you have been granted in this community.

No
Yes

Preparing word cloud

×

Plasmids are provided by Addgene and DGRC.

Search

Type in a keyword to search

Filter by records added date
See new records

Options


Current Facets and Filters

  • Bacterial Resistance:none (facet)


Recent searches

Snippet view Table view
Click the to add this resource to a Collection

199 Results - per page

Show More Columns | Download 199 Result(s)

Plasmid Name Proper Citation Insert Name Organism Bacterial Resistance Defining Citation Comments Vector Backbone Description Relevant Mutation Record Last Update Mentions Count
BL21ΔBC
 
Resource Report
Resource Website
RRID:Addgene_102263 None PMID:29164072 Genotype = ΔlamB ΔompC Precursor strain = BL21Gold(DE3) [genotype F- ompT hsdS(rB– mB– ) dcm+ Tetr gal λ(DE3) endA Hte] Supplemental document contains a list of genotypes and PCR primers used for verification of each knocked-out gene Vector Backbone:none; Vector Types:; Bacterial Resistance:None 2026-09-12 02:13:49 0
BL21ΔCF
 
Resource Report
Resource Website
RRID:Addgene_102265 None PMID:29164072 Genotype = ΔompC ΔompF Precursor strain = BL21Gold(DE3) [genotype F- ompT hsdS(rB– mB– ) dcm+ Tetr gal λ(DE3) endA Hte] Supplemental document contains a list of genotypes and PCR primers used for verification of each knocked-out gene Vector Backbone:none; Vector Types:; Bacterial Resistance:None 2026-09-12 02:13:49 0
BL21ΔAF
 
Resource Report
Resource Website
RRID:Addgene_102262 None PMID:29164072 Genotype = ΔompA ΔompF Precursor strain = BL21Gold(DE3) [genotype F- ompT hsdS(rB– mB– ) dcm+ Tetr gal λ(DE3) endA Hte] Supplemental document contains a list of genotypes and PCR primers used for verification of each knocked-out gene Vector Backbone:none; Vector Types:; Bacterial Resistance:None 2026-09-12 02:13:49 0
BL21ΔA
 
Resource Report
Resource Website
1+ mentions
RRID:Addgene_102256 None PMID:29164072 Genotype = ΔompA Precursor strain = BL21Gold(DE3) [genotype F- ompT hsdS(rB– mB– ) dcm+ Tetr gal λ(DE3) endA Hte] Supplemental document contains a list of genotypes and PCR primers used for verification of each knocked-out gene Vector Backbone:none; Vector Types:; Bacterial Resistance:None 2026-09-12 02:13:48 1
BL21ΔB
 
Resource Report
Resource Website
RRID:Addgene_102257 None PMID:29164072 Genotype = ΔlamB Precursor strain = BL21Gold(DE3) [genotype F- ompT hsdS(rB– mB– ) dcm+ Tetr gal λ(DE3) endA Hte] Supplemental document contains a list of genotypes and PCR primers used for verification of each knocked-out gene Vector Backbone:none; Vector Types:; Bacterial Resistance:None 2026-09-12 02:13:48 0
BL21ΔABC
 
Resource Report
Resource Website
RRID:Addgene_102266 None PMID:29164072 Genotype = ΔompA ΔlamB ΔompC Precursor strain = BL21Gold(DE3) [genotype F- ompT hsdS(rB– mB– ) dcm+ Tetr gal λ(DE3) endA Hte] Supplemental document contains a list of genotypes and PCR primers used for verification of each knocked-out gene Vector Backbone:none; Vector Types:; Bacterial Resistance:None 2026-09-12 02:13:49 0
BL21ΔABF
 
Resource Report
Resource Website
RRID:Addgene_102267 None PMID:29164072 Genotype = ΔompA ΔlamB ΔompF Precursor strain = BL21Gold(DE3) [genotype F- ompT hsdS(rB– mB– ) dcm+ Tetr gal λ(DE3) endA Hte] Supplemental document contains a list of genotypes and PCR primers used for verification of each knocked-out gene Vector Backbone:none; Vector Types:; Bacterial Resistance:None 2026-09-12 02:13:49 0
RF15
 
Resource Report
Resource Website
RRID:Addgene_102799 none None PMID:33289521 This work is supported in part by JSPS-NSF International Collaborations in Chemistry (ICC) research grant. Genotype= aspC tyrB trpA trpB glyA serB Precursor strain = RF14 Modified from the parent Escherichia coli BL21(DE3) strain Selective amino acid labeling (and/or requirement) = Asp, Tyr, Trp, (Phe), Gly, Ser+++++ +++++ RF15 has knockouts in aspC, tyrB, trpA, trpB, glyA and serB genes and requires the presence of L-Asp, L-Tyr, L-Trp, L-Gly plus L-Ser for growth in M63 minimal medium, but it does NOT grow in the presence of L-Asp, L-Tyr, L-Trp, L-Gly, L-Ser plus L-Cys (either in the presence or absence of L-Ala) (i.e., L-Cys inhibits the growth of RF15) Please visit the following links for additional details on this strain and selective amino acid labeling- http://www2.nms.ac.jp/fesworld/EcoliStrains.html http://www2.nms.ac.jp/fesworld/EcoliStrainsSuppl.html Note that these strains are NOT competent cells and one needs to make them competent before use. Supplemental documents contain a list of PCR primers used for verification of each knocked-out gene as well as an image showing PCR results for this strain. Supporting References: Lin, M. T., Fukazawa, R., Miyajima-Nakano, Y., Matsushita, S., Choi, S. K., Iwasaki, T., and Gennis, R. B. (2015) Escherichia coliauxotroph host strains for amino acid-selective isotope labeling of recombinant proteins. Methods Enzymol. (Isotope Labeling of Biomolecules - Labeling Methods), 565, 45-66. Iwasaki, T., Fukazawa, R., Miyajima-Nakano, Y., Baldansuren, A., Matsushita, S., Lin, M. T., Gennis, R. B., Hasegawa, K., Kumasaka, T., and Dikanov, S. A. (2012) Dissection of hydrogen bond interaction network around an iron-sulfur cluster by site-specific isotope labeling of hyperthermophilic archaeal Rieske-type ferredoxin. J. Am. Chem. Soc. 134, 19731-19738. Lin, M. T., Sperling, L. J., Frericks Schmidt, H. L., Tang, M., Samoilova, R. I., Kumasaka, T., Iwasaki, T., Dikanov, S. A., Rienstra, C. M., and Gennis, R. B. (2011) A rapid and robust method for selective isotope labeling of proteins. Methods 55, 370-378. Vector Backbone:none; Vector Types:; Bacterial Resistance:None 2026-09-12 02:13:52 0
RF21
 
Resource Report
Resource Website
RRID:Addgene_102803 none None PMID:33289521 This work is supported in part by JSPS-NSF International Collaborations in Chemistry (ICC) research grant. Genotype= aspC tyrB ilvE avtA yfbQ(alaA) yfdZ(alaC) Precursor strain = RF18 Modified from the parent Escherichia coli BL21(DE3) strain Selective amino acid labeling (and/or requirement) = Asp, Tyr, Phe, Ile, Leu, Val#### #### RF21 has knockouts in the four general transaminase genes of E. coli (aspC, tyrB, ilvE, and avtA) and is found to require the presence of L-Asp, L-Tyr, L-Phe, L-Ile, L-Leu plus L-Val for slow growth in M63 minimal medium. Although RF21 strain has further knockouts in yfbQ (alaA) and yfdZ (alaC) genes, it is NOT an L-Ala auxotroph, either (requiring the presence of L-Asp, L-Tyr, L-Phe, L-Ile, L-Leu plus L-Val for slow growth in M63 minimal medium, like RF18). Please visit the following links for additional details on this strain and selective amino acid labeling- http://www2.nms.ac.jp/fesworld/EcoliStrains.html http://www2.nms.ac.jp/fesworld/EcoliStrainsSuppl.html Note that these strains are NOT competent cells and one needs to make them competent before use. Supplemental documents contain a list of PCR primers used for verification of each knocked-out gene as well as an image showing PCR results for this strain. Supporting References: Lin, M. T., Fukazawa, R., Miyajima-Nakano, Y., Matsushita, S., Choi, S. K., Iwasaki, T., and Gennis, R. B. (2015) Escherichia coliauxotroph host strains for amino acid-selective isotope labeling of recombinant proteins. Methods Enzymol. (Isotope Labeling of Biomolecules - Labeling Methods), 565, 45-66. Iwasaki, T., Fukazawa, R., Miyajima-Nakano, Y., Baldansuren, A., Matsushita, S., Lin, M. T., Gennis, R. B., Hasegawa, K., Kumasaka, T., and Dikanov, S. A. (2012) Dissection of hydrogen bond interaction network around an iron-sulfur cluster by site-specific isotope labeling of hyperthermophilic archaeal Rieske-type ferredoxin. J. Am. Chem. Soc. 134, 19731-19738. Lin, M. T., Sperling, L. J., Frericks Schmidt, H. L., Tang, M., Samoilova, R. I., Kumasaka, T., Iwasaki, T., Dikanov, S. A., Rienstra, C. M., and Gennis, R. B. (2011) A rapid and robust method for selective isotope labeling of proteins. Methods 55, 370-378. Vector Backbone:none; Vector Types:; Bacterial Resistance:None 2026-09-12 02:13:52 0
RF18
 
Resource Report
Resource Website
RRID:Addgene_102802 none None PMID:33289521 This work is supported in part by JSPS-NSF International Collaborations in Chemistry (ICC) research grant. Genotype= aspC tyrB ilvE avtA Precursor strain = RF17 Modified from the parent Escherichia coli BL21(DE3) strain Selective amino acid labeling (and/or requirement) = Asp, Tyr, Phe, Ile, Leu, Val#### ####RF18 has knockouts in the four general transaminase genes of E. coli (aspC, tyrB, ilvE, and avtA) and is found to require the presence of L-Asp, L-Tyr, L-Phe, L-Ile, L-Leu plus L-Val for slow growth in M63 minimal medium. Please visit the following links for additional details on this strain and selective amino acid labeling- http://www2.nms.ac.jp/fesworld/EcoliStrains.html http://www2.nms.ac.jp/fesworld/EcoliStrainsSuppl.html Note that these strains are NOT competent cells and one needs to make them competent before use. Supplemental documents contain a list of PCR primers used for verification of each knocked-out gene as well as an image showing PCR results for this strain. Supporting References: Lin, M. T., Fukazawa, R., Miyajima-Nakano, Y., Matsushita, S., Choi, S. K., Iwasaki, T., and Gennis, R. B. (2015) Escherichia coliauxotroph host strains for amino acid-selective isotope labeling of recombinant proteins. Methods Enzymol. (Isotope Labeling of Biomolecules - Labeling Methods), 565, 45-66. Iwasaki, T., Fukazawa, R., Miyajima-Nakano, Y., Baldansuren, A., Matsushita, S., Lin, M. T., Gennis, R. B., Hasegawa, K., Kumasaka, T., and Dikanov, S. A. (2012) Dissection of hydrogen bond interaction network around an iron-sulfur cluster by site-specific isotope labeling of hyperthermophilic archaeal Rieske-type ferredoxin. J. Am. Chem. Soc. 134, 19731-19738. Lin, M. T., Sperling, L. J., Frericks Schmidt, H. L., Tang, M., Samoilova, R. I., Kumasaka, T., Iwasaki, T., Dikanov, S. A., Rienstra, C. M., and Gennis, R. B. (2011) A rapid and robust method for selective isotope labeling of proteins. Methods 55, 370-378. Vector Backbone:none; Vector Types:; Bacterial Resistance:None 2026-09-12 02:13:52 0
LC-E18
 
Resource Report
Resource Website
RRID:Addgene_115924 none None PMID:29765036 E. coli K12 MG1655 genotype: F- λ- ilvG- rfb-50 rph-1 Integration at lambda attB: pOSIP-KL-sulA-GFP Integration at HK022 attB: pOSIP-KO-RBS2-dCas9 SulA-GFP acts as an SOS response reporter. Vector Backbone:none; Vector Types:; Bacterial Resistance:None 2026-09-12 02:15:57 0
AV04
 
Resource Report
Resource Website
RRID:Addgene_115926 none None PMID:29765036 E. coli K12 MG1655 genotype: F- λ- ilvG- rfb-50 rph-1 Integration at lambda attB: pOSIP-KL-mCherry Integration at primary 186 attB: pOSIP-KO-RBS2-dCas9 mCherry quantifies dCas9 repression Vector Backbone:none; Vector Types:; Bacterial Resistance:None 2026-09-12 02:15:57 0
MG1655 Z1 malE
 
Resource Report
Resource Website
1+ mentions
RRID:Addgene_65915 MG1655 Z1 malE None PMID:26900850 F-, lambda-, rph-1, laciq, PN25-tetR, SpR, malE- Vector Backbone:n/a; Vector Types:; Bacterial Resistance:None 2026-09-12 02:30:28 1
B95 ΔAΔfabRΔselABC
 
Resource Report
Resource Website
RRID:Addgene_234550 None None PMID:34411545 Genotype: The same as BL21(DE3) except for the additional mutations at 95 UAG codons, disruption of prfA, and frameshift in fabR and deletion of selABC. Vector Backbone:N/A; Vector Types:; Bacterial Resistance:None 2026-09-12 02:43:44 0
TB201
 
Resource Report
Resource Website
RRID:Addgene_230031 MG1655 attP21::PR-mYFP::frt None PMID:29355812 Strain Validation: Fluorescence, PCR for fluorescent marker gene. Inserted into attP21 and PCR-verified following methods described in Haldimann and Wanner, JBact 2001, PMID 11591683, using pAH68FRT-Cat as cloning and insertion plasmid. Vector Backbone:NA; Vector Types:; Bacterial Resistance:None 2026-09-12 02:42:47 0
TB205
 
Resource Report
Resource Website
RRID:Addgene_230034 MG1655 attP21::PR-mCherry::frt None PMID:28428424 Strain Validation: Fluorescence, PCR for fluorescent marker gene. Inserted into attP21 and PCR-verified following methods described in Haldimann and Wanner, JBact 2001, PMID 11591683, using pAH68FRT-Cat as cloning and insertion plasmid. TB205 is fliC+ and wrongly annotated as ∆fliC in PMID 28428424. Vector Backbone:NA; Vector Types:; Bacterial Resistance:None 2026-09-12 02:42:47 0
TB204
 
Resource Report
Resource Website
RRID:Addgene_230033 MG1655 attP21::PR-sfGFP::frt None PMID:29355812 Strain Validation: Fluorescence, PCR for fluorescent marker gene. Inserted into attP21 and PCR-verified following methods described in Haldimann and Wanner, JBact 2001, PMID 11591683, using pAH68FRT-Cat as cloning and insertion plasmid. Vector Backbone:NA; Vector Types:; Bacterial Resistance:None 2026-09-12 02:42:47 0
TB202
 
Resource Report
Resource Website
RRID:Addgene_230032 MG1655 attP21::PR-mCerulean::frt None Strain Validation: Fluorescence, PCR for fluorescent marker gene. Inserted into attP21 and PCR-verified following methods described in Haldimann and Wanner, JBact 2001, PMID 11591683, using pAH68FRT-Cat as cloning and insertion plasmid. Vector Backbone:NA; Vector Types:; Bacterial Resistance:None 2026-09-12 02:42:47 0
TB205 △trpC
 
Resource Report
Resource Website
RRID:Addgene_230038 MG1655 attP21::PR-mCherry::frt trpC::frt None PMID:32042125 Strain Validation: Fluorescence, growth in M9+glucose +/- tryptophane, PCRs with primers flanking fluorescent marker gene or deleted gene. Primers: trpC_fwd: AACGTCGCCATGTTAATGCG trpC_rev: GAACTGAGCCTGAAATTCAGG Vector Backbone:NA; Vector Types:; Bacterial Resistance:None 2026-09-12 02:42:46 0
TB204 △trpC
 
Resource Report
Resource Website
RRID:Addgene_230037 MG1655 attP21::PR-sfGFP::frt trpC::frt None PMID:32042125 Strain Validation: Fluorescence, growth in M9+glucose +/- tryptophane, PCRs with primers flanking fluorescent marker gene or deleted gene. Primers: trpC_fwd: AACGTCGCCATGTTAATGCG trpC_rev: GAACTGAGCCTGAAATTCAGG Vector Backbone:NA; Vector Types:; Bacterial Resistance:None 2026-09-12 02:42:46 0

Can't find your Plasmid?

We recommend that you click next to the search bar to check some helpful tips on searches and refine your search firstly. If you want to find a specific plasmid, it's easier to enter an RRID or an Addgene Catalog Number to search. You can refine the search results using Facets on the left side of the search results page. If you are on the table view, you can also search in a specific column by clicking the column title and enter the keywords.

If you still could not find your plasmid in the search results, please help us by registering it into the system — it's easy. Register it with Addgene.

Can't find the RRID you're searching for? X
X
  1. Neuroscience Information Framework Resources

    Welcome to the NIF Resources search. From here you can search through a compilation of resources used by NIF and see how data is organized within our community.

  2. Navigation

    You are currently on the Community Resources tab looking through categories and sources that NIF has compiled. You can navigate through those categories from here or change to a different tab to execute your search through. Each tab gives a different perspective on data.

  3. Logging in and Registering

    If you have an account on NIF then you can log in from here to get additional features in NIF such as Collections, Saved Searches, and managing Resources.

  4. Searching

    Here is the search term that is being executed, you can type in anything you want to search for. Some tips to help searching:

    1. Use quotes around phrases you want to match exactly
    2. You can manually AND and OR terms to change how we search between words
    3. You can add "-" to terms to make sure no results return with that term in them (ex. Cerebellum -CA1)
    4. You can add "+" to terms to require they be in the data
    5. Using autocomplete specifies which branch of our semantics you with to search and can help refine your search
  5. Collections

    If you are logged into NIF you can add data records to your collections to create custom spreadsheets across multiple sources of data.

  6. Facets

    Here are the facets that you can filter the data by.

  7. Further Questions

    If you have any further questions please check out our FAQs Page to ask questions and see our tutorials. Click this button to view this tutorial again.