Are you sure you want to leave this community? Leaving the community will revoke any permissions you have been granted in this community.
Species: E. coli
Genetic Insert: LexAp65
Vector Backbone Description: Backbone Marker:Invitrogen; Backbone Size:2551; Vector Backbone:pDONR P5-P2; Vector Types:Bacterial Expression; Bacterial Resistance:Kanamycin
References:
Comments:
Proper citation: RRID:Addgene_41437 Copy
Species: Neurospora crassa
Genetic Insert: 10XQUAS
Vector Backbone Description: Backbone Marker:Invitrogen; Backbone Size:2551; Vector Backbone:pDONR P1-P4; Vector Types:Bacterial Expression; Bacterial Resistance:Kanamycin
References:
Comments:
Proper citation: RRID:Addgene_41436 Copy
Species: E.coli
Genetic Insert: 13XLexAop2
Vector Backbone Description: Backbone Marker:Invitrogen; Backbone Size:2603; Vector Backbone:pDONR P1-P4; Vector Types:Bacterial Expression; Bacterial Resistance:Kanamycin
References:
Comments:
Proper citation: RRID:Addgene_41434 Copy
Species: Homo sapiens
Genetic Insert: RIP1
Vector Backbone Description: Backbone Marker:Clontech; Backbone Size:4700; Vector Backbone:pEGFP-N1; Vector Types:Mammalian Expression; Bacterial Resistance:Kanamycin
References:
Comments:
Proper citation: RRID:Addgene_41389 Copy
Species: Mus musculus
Genetic Insert: RIP3
Vector Backbone Description: Backbone Marker:Clontech; Backbone Size:4700; Vector Backbone:pEGFP-N1; Vector Types:Mammalian Expression; Bacterial Resistance:Kanamycin
References:
Comments:
Proper citation: RRID:Addgene_41384 Copy
Species: Mus musculus
Genetic Insert: RIP3
Vector Backbone Description: Backbone Marker:Clontech; Backbone Size:4700; Vector Backbone:pEGFP-N1; Vector Types:Mammalian Expression; Bacterial Resistance:Kanamycin
References:
Comments:
Proper citation: RRID:Addgene_41383 Copy
Species: Homo sapiens
Genetic Insert: SIRT6
Vector Backbone Description: Backbone Marker:SGC; Vector Backbone:pET28a-LIC; Vector Types:Bacterial Expression; Bacterial Resistance:Kanamycin
References:
Comments: http://www.thesgc.org/structures/3PKI/
Proper citation: RRID:Addgene_41565 Copy
Species: Bos taurus
Genetic Insert: supervillin
Vector Backbone Description: Backbone Marker:Clontech; Backbone Size:4731; Vector Backbone:pEGFP-C1; Vector Types:Mammalian Expression; Bacterial Resistance:Kanamycin
References:
Comments:
Proper citation: RRID:Addgene_41661 Copy
Species: Synthetic
Genetic Insert: Polylinker flanked by 2 Mva1269I cut sites
Vector Backbone Description: Backbone Marker:Clontech; Backbone Size:2638; Vector Backbone:pEGFP-N1Δ4728-2101; Vector Types:Mammalian Expression; Bacterial Resistance:Kanamycin
References:
Comments:
Proper citation: RRID:Addgene_41516 Copy
Species: Thermoplasma volcanium
Genetic Insert: Tvo VMA intein
Vector Backbone Description: Backbone Marker:novagen; Vector Backbone:pRSFDuet-1; Vector Types:Bacterial Expression; Bacterial Resistance:Kanamycin
References:
Comments:
Proper citation: RRID:Addgene_41689 Copy
Species: Homo sapiens
Genetic Insert: gRNA_DNMT3b
Vector Backbone Description: Backbone Marker:Invitrogen; Vector Backbone:pCR-Blunt II-TOPO; Vector Types:Mammalian Expression, CRISPR; Bacterial Resistance:Kanamycin
References:
Comments: gRNA target sequence GAATTACTCACGCCCCAAGG
Proper citation: RRID:Addgene_41823 Copy
Species:
Genetic Insert: gRNA_AAVS1-T2
Vector Backbone Description: Backbone Marker:Invitrogen; Vector Backbone:pCR-Blunt II-TOPO; Vector Types:Mammalian Expression, CRISPR; Bacterial Resistance:Kanamycin
References:
Comments: gRNA target sequence GGGGCCACTAGGGACAGGAT
Proper citation: RRID:Addgene_41818 Copy
Species:
Genetic Insert: gRNA_AAVS1-T1
Vector Backbone Description: Backbone Marker:Invitrogen; Vector Backbone:pCR-Blunt II-TOPO; Vector Types:Mammalian Expression, CRISPR; Bacterial Resistance:Kanamycin
References:
Comments: gRNA target sequence GTCCCCTCCACCCCACAGTG
Proper citation: RRID:Addgene_41817 Copy
Species: Pyrococcus horikoshii
Genetic Insert: PhoCDC21-1 intein
Vector Backbone Description: Backbone Marker:novagen; Vector Backbone:pRSFDuet-1; Vector Types:Bacterial Expression; Bacterial Resistance:Kanamycin
References:
Comments:
Proper citation: RRID:Addgene_41695 Copy
Species: Methanococcus jannaschii
Genetic Insert: MjaTFIIB intein
Vector Backbone Description: Backbone Marker:novagen; Vector Backbone:pRSFDuet-1; Vector Types:Bacterial Expression; Bacterial Resistance:Kanamycin
References:
Comments:
Proper citation: RRID:Addgene_41694 Copy
Species: Homo sapiens
Genetic Insert: ubiquitin specific peptidase 28
Vector Backbone Description: Backbone Size:4261; Vector Backbone:phCMV2; Vector Types:Mammalian Expression; Bacterial Resistance:Kanamycin
References:
Comments:
Proper citation: RRID:Addgene_41948 Copy
Species: Homo sapiens
Genetic Insert: TNRC6A
Vector Backbone Description: Backbone Size:5311; Vector Backbone:pET28a; Vector Types:Bacterial Expression; Bacterial Resistance:Kanamycin
References:
Comments:
Proper citation: RRID:Addgene_42050 Copy
Species: Homo sapiens
Genetic Insert: TNRC6A
Vector Backbone Description: Backbone Size:5311; Vector Backbone:pET28a; Vector Types:Bacterial Expression; Bacterial Resistance:Kanamycin
References:
Comments:
Proper citation: RRID:Addgene_42051 Copy
Species: Synthetic
Genetic Insert: pCMV-N1-superfolderGFP
Vector Backbone Description: Vector Backbone:pNICE; Vector Types:Mammalian Expression; Bacterial Resistance:Kanamycin
References:
Comments:
Proper citation: RRID:Addgene_42143 Copy
Species:
Genetic Insert:
Vector Backbone Description: Backbone Marker:Joung lab DR274; Backbone Size:2147; Vector Backbone:Zebrafish-gRNA-ExpressionVector; Vector Types:Worm Expression, CRISPR, zebrafish expression; Bacterial Resistance:Kanamycin
References:
Comments:
Proper citation: RRID:Addgene_42250 Copy
Can't find your Plasmid?
We recommend that you click next to the search bar to check some helpful tips on searches and refine your search firstly. If you want to find a specific plasmid, it's easier to enter an RRID or an Addgene Catalog Number to search. You can refine the search results using Facets on the left side of the search results page. If you are on the table view, you can also search in a specific column by clicking the column title and enter the keywords.
If you still could not find your plasmid in the search results, please help us by registering it into the system — it's easy. Register it with Addgene.
Welcome to the NIF Resources search. From here you can search through a compilation of resources used by NIF and see how data is organized within our community.
You are currently on the Community Resources tab looking through categories and sources that NIF has compiled. You can navigate through those categories from here or change to a different tab to execute your search through. Each tab gives a different perspective on data.
If you have an account on NIF then you can log in from here to get additional features in NIF such as Collections, Saved Searches, and managing Resources.
Here is the search term that is being executed, you can type in anything you want to search for. Some tips to help searching:
You can save any searches you perform for quick access to later from here.
We recognized your search term and included synonyms and inferred terms along side your term to help get the data you are looking for.
If you are logged into NIF you can add data records to your collections to create custom spreadsheets across multiple sources of data.
Here are the sources that were queried against in your search that you can investigate further.
Here are the categories present within NIF that you can filter your data on
Here are the subcategories present within this category that you can filter your data on
If you have any further questions please check out our FAQs Page to ask questions and see our tutorials. Click this button to view this tutorial again.