Searching the RRID Resource Information Network
Are you sure you want to leave this community? Leaving the community will revoke any permissions you have been granted in this community.
Species: Homo sapiens
Genetic Insert: RAB25:HPC038-B06:C25773
Vector Backbone Description: Backbone Marker:SGC; Backbone Size:7328; Vector Backbone:pET28a-LIC; Vector Types:Bacterial Expression; Bacterial Resistance:Kanamycin
Comments: PDB: 2OIL
http://www.thesgc.org/structures/2OIL/
Proper citation: RRID:Addgene_26163 Copy
Species: Schmidtea mediterranea
Genetic Insert: Smed-NF-YB
Vector Backbone Description: Backbone Size:2650; Vector Backbone:pPR244; Vector Types:RNAi; Bacterial Resistance:Kanamycin
Defining Citation: PMID:20844018
Proper citation: RRID:Addgene_26147 Copy
Species: Schmidtea mediterranea
Genetic Insert: Smed-elav1
Vector Backbone Description: Backbone Size:2650; Vector Backbone:pPR244; Vector Types:RNAi; Bacterial Resistance:Kanamycin
Defining Citation: PMID:20844018
Proper citation: RRID:Addgene_26143 Copy
Species: Schmidtea mediterranea
Genetic Insert: Smed-hnRNPA2
Vector Backbone Description: Backbone Size:2650; Vector Backbone:pPR244; Vector Types:RNAi; Bacterial Resistance:Kanamycin
Defining Citation: PMID:20844018
Proper citation: RRID:Addgene_26145 Copy
Species: Schmidtea mediterranea
Genetic Insert: Smed-eIF3c
Vector Backbone Description: Backbone Size:2650; Vector Backbone:pPR244; Vector Types:RNAi; Bacterial Resistance:Kanamycin
Defining Citation: PMID:20844018
Proper citation: RRID:Addgene_26142 Copy
Species: Mycobacterium marinum + Photorhabdus luminescens
Genetic Insert: G13 promoter + Bacterial luciferase operon
Vector Backbone Description: Backbone Size:4373; Vector Backbone:pMV306hsp; Vector Types:Bacterial Expression; Bacterial Resistance:Kanamycin
Defining Citation: PMID:20520722
Comments: The sequence of the Lux operon is theoretical. As such, there are a few differences between Addgene sequence and full plasmid sequence. These differences do not affect plasmid function.
Qazi, S.N., et al., agr expression precedes escape of internalized Staphylococcus aureus from the host endosome. Infect Immun, 2001. 69(11): p. 7074-82.
Proper citation: RRID:Addgene_26160 Copy
Species: Mycobacterium bovis BCG
Genetic Insert: hsp60 promoter
Vector Backbone Description: Backbone Size:3938; Vector Backbone:pMV306; Vector Types:Mycobacteria integrating vector; Bacterial Resistance:Kanamycin
Defining Citation: PMID:20520722
Comments: There are a few sequence discrepancies between author sequence and Addgene quality control sequence for the hsp promoter. The hsp promoter sequence was taken from the pSMT3 vector and is theoretical sequence. These differences do not affect function.
Garbe, T.R., et al., Transformation of mycobacterial species using hygromycin resistance as selectable marker. Microbiology, 1994. 140 ( Pt 1): p. 133-8.
Proper citation: RRID:Addgene_26155 Copy
Species: Photinus pyralis
Genetic Insert: Firefly luciferase
Vector Backbone Description: Backbone Size:4373; Vector Backbone:pMV306hsp; Vector Types:Bacterial Expression; Bacterial Resistance:Kanamycin
Defining Citation: PMID:20520722
Proper citation: RRID:Addgene_26156 Copy
Species: Schmidtea mediterranea
Genetic Insert: Smed-sped-1
Vector Backbone Description: Backbone Size:2650; Vector Backbone:pPR244; Vector Types:RNAi; Bacterial Resistance:Kanamycin
Defining Citation: PMID:20844018
Proper citation: RRID:Addgene_26151 Copy
Genetic Insert: None
Vector Backbone Description: Backbone Marker:Structural Genomics Consortium; Backbone Size:7328; Vector Backbone:pET28a-LIC; Vector Types:Bacterial Expression; Bacterial Resistance:Kanamycin
Comments: http://www.sgc.utoronto.ca/SGC-WebPages/toronto-vectors.php
Proper citation: RRID:Addgene_26094 Copy
Species: Rattus norvegicus
Genetic Insert: Synaptophysin GCaMP2
Vector Backbone Description: Backbone Size:3957; Vector Backbone:pEGFP-N1 (Clontech); Vector Types:Mammalian Expression; Bacterial Resistance:Kanamycin
Defining Citation: PMID:19898484
Comments: ORF frame 3 (624-2915): Rat SyGCaMP2.
Our sequence with CMV-F shows a mutation S199T in Synaptophysin ORF. This change does not have any effect in localizing the construct to the synaptic vesicle and may be a result of a SNP.
Proper citation: RRID:Addgene_26124 Copy
Vector Backbone Description: Backbone Marker:Structural Genomics Consortium; Backbone Size:7325; Vector Backbone:pET28-MHL; Vector Types:Bacterial Expression; Bacterial Resistance:Kanamycin
Comments: The pET28-MHL vector (GenBank accession EF456735) was derived from expression plasmid pET28a-LIC (SGC). It is used for T7 promoter driven expression of recombinant proteins with the addition of an 18 amino acid N-terminal fusion tag containing 6X His followed by a TEV cleavage site. The GSS residues after the Met start site were removed to reduce N-terminal gluconoylation via preventing N-terminal Met excision. Two stop codons are included in the vector at the C-terminal cloning site.
Insertion of DNA sequence into the cloning/expression region is performed using BD-Biosciences Infusion enzyme mediated directional recombination between complementary 15 nucleotide DNA sequences at the ends of the insert (PCR product) and BseRI linearized vector. Insertion of target sequence involves replacement of a SacB gene stuffer sequence, which provides for negative selection of the original plasmid on 5% sucrose.
http://www.sgc.utoronto.ca/SGC-WebPages/toronto-vectors.php
Proper citation: RRID:Addgene_26096 Copy
Vector Backbone Description: Backbone Marker:SGC Oxford; Backbone Size:7218; Vector Backbone:pNIC-CH; Vector Types:Bacterial Expression; Bacterial Resistance:Kanamycin
Comments: pET expression vector with C-terminal His6 tag. Includes sites for LIC cloning, and a “stuffer” fragment that includes the SacB gene, allowing negative selection on 5% sucrose. GenBank accession number: EF199843
Primers for LIC cloning:
Add the following 5’ extensions to the PCR primers:
Upstream: TTAAGAAGGAGATATACTATG (ATG-initiation codon)
Downstream: AATGGTGGTGATGATGGTGCGC
The purified PCR fragments are treated with T4 DNA polymerase and dGTP, then annealed to the treated vector. See supplemental document for more information.
Proper citation: RRID:Addgene_26117 Copy
Vector Backbone Description: Backbone Size:3845; Vector Backbone:pBTBXh-2; Vector Types:Bacterial Expression; Bacterial Resistance:Kanamycin
Defining Citation: PMID:20148414
Comments: There is an extra G in the middle of the alignment between Addgene's quality control sequence and the author's sequence. This discrepancy is in a non-coding region and does affect function.
Proper citation: RRID:Addgene_26078 Copy
Vector Backbone Description: Backbone Size:5076; Vector Backbone:pBMTBX-2; Vector Types:Bacterial Expression; Bacterial Resistance:Kanamycin
Defining Citation: PMID:20148414
Proper citation: RRID:Addgene_26073 Copy
Species: Homo sapiens
Genetic Insert: Tet transactivator, enhanced green fluorescent protein, TVA, rabies B19 glycoprotein
Vector Backbone Description: Backbone Marker:Mr. Gene; Backbone Size:3300; Vector Backbone:pAAV; Vector Types:AAV, Cre/Lox, Adeno-associated virus; Bacterial Resistance:Kanamycin
Defining Citation: PMID:21115815
Proper citation: RRID:Addgene_26196 Copy
Species: Homo sapiens
Genetic Insert: Mediator of DNA damage checkpoint 1
Vector Backbone Description: Backbone Marker:Invitrogen; Backbone Size:2477; Vector Backbone:pENTR4; Vector Types:Gateway Cloning; Bacterial Resistance:Kanamycin
Proper citation: RRID:Addgene_26427 Copy
Species: Mus musculus
Genetic Insert: cytoplasmic dynein 1 intermediate chain 1 isoform B
Vector Backbone Description: Backbone Marker:Invitrogen; Backbone Size:3956; Vector Backbone:pCR4-TOPO; Vector Types:subcloning and sequencing; Bacterial Resistance:Kanamycin
Defining Citation: PMID:20657784
Proper citation: RRID:Addgene_26435 Copy
Genetic Insert: Cerulean-32-Venus
Vector Backbone Description: Backbone Marker:Clonetech; Backbone Size:3937; Vector Backbone:EGFP N1; Vector Types:Mammalian Expression, FRET standard; Bacterial Resistance:Kanamycin
Defining Citation: PMID:17040988
Comments: This construct contains Cerulean attached via a 32 amino acid linker to Venus. See supplemental methods section in associated paper for further details of plasmid construction.
Proper citation: RRID:Addgene_26396 Copy
Species: Homo sapiens
Genetic Insert: SOD1
Vector Backbone Description: Backbone Marker:Clontech; Backbone Size:4700; Vector Backbone:pAcGFP1-N1; Vector Types:Mammalian Expression; Bacterial Resistance:Kanamycin
Defining Citation: PMID:20221404
Comments: The complete cDNA was subcloned into the vector pET28. Site directed mutagenesis changed wildtype DNA sequence for codon 37 of the cDNA from GGA to AGA, resulting in the G37R mutation in the protein and then a PCR amplified the complete cDNA with EcoRI and SalI sites on the 5’ and 3’ end respectively. This EcoRI-Sal1 0.47kb fragment was cloned into the respective EcoRI and SalI sites of pAcGFP1N1. Thus SOD1 is 5’ of GFP and SOD1 lies upstream of GFP in the SOD1-GFP fusion protein.
Proper citation: RRID:Addgene_26409 Copy
Can't find your Plasmid?
We recommend that you click next to the search bar to check some helpful tips on searches and refine your search firstly. If you want to find a specific plasmid, it's easier to enter an RRID or an Addgene Catalog Number to search. You can refine the search results using Facets on the left side of the search results page. If you are on the table view, you can also search in a specific column by clicking the column title and enter the keywords.
If you still could not find your plasmid in the search results, please help us by registering it into the system — it's easy. Register it with Addgene.
Welcome to the NIF Resources search. From here you can search through a compilation of resources used by NIF and see how data is organized within our community.
You are currently on the Community Resources tab looking through categories and sources that NIF has compiled. You can navigate through those categories from here or change to a different tab to execute your search through. Each tab gives a different perspective on data.
If you have an account on NIF then you can log in from here to get additional features in NIF such as Collections, Saved Searches, and managing Resources.
Here is the search term that is being executed, you can type in anything you want to search for. Some tips to help searching:
You can save any searches you perform for quick access to later from here.
We recognized your search term and included synonyms and inferred terms along side your term to help get the data you are looking for.
If you are logged into NIF you can add data records to your collections to create custom spreadsheets across multiple sources of data.
Here are the sources that were queried against in your search that you can investigate further.
Here are the categories present within NIF that you can filter your data on
Here are the subcategories present within this category that you can filter your data on
If you have any further questions please check out our FAQs Page to ask questions and see our tutorials. Click this button to view this tutorial again.
Welcome to the Neuroscience Information Framework Project, designed to serve the biomedical research community. NIF maintains the largest searchable collection of neuroscience data, the largest catalog of biomedical resources, and the largest ontology for neuroscience on the web. We welcome all feedback and suggestions and are actively looking for resource providers to make their resources accessible through NIF. Learn about the tools available to help you share your data and discover a dynamic inventory of Web-based neuroscience resources.
