Searching the RRID Resource Information Network
Are you sure you want to leave this community? Leaving the community will revoke any permissions you have been granted in this community.
| Plasmid Name | Proper Citation | Insert Name | Organism | Bacterial Resistance | Defining Citation |
Comments |
||||
|---|---|---|---|---|---|---|---|---|---|---|
|
pMDC32_PbGH3 Resource Report Resource Website |
RRID:Addgene_232335 | PbGH3 | Plasmodiophora brassicae | Hygromycin | Backbone Marker:Thermo Fisher Scientific; Backbone Size:10141; Vector Backbone:pMDC32; Vector Types:Plant Expression; Bacterial Resistance:Hygromycin | 2026-09-12 02:43:01 | 0 | |||
|
pNK7188 Resource Report Resource Website |
RRID:Addgene_219768 | Pv4CL1 | Panicum virgatum | Hygromycin | PMID:38457503 | Backbone Size:4111; Vector Backbone:MoClo adapted pGAPZ-vector with hygromycin resistance; Vector Types:Yeast Expression; Bacterial Resistance:Hygromycin | 2026-09-12 02:41:12 | 0 | ||
|
pJMP3667 Resource Report Resource Website |
RRID:Addgene_222353 | sfGFP | Derived from Aequorea victoria. | Hygromycin | PMID:39302127 | Shuttle vector that replicates in A. baumannii and E. coli; replicates in common cloning strains such as DH10B. | Vector Backbone:p15A and pWH1266; Vector Types:Bacterial Expression; Bacterial Resistance:Hygromycin | 2026-09-12 02:41:21 | 0 | |
|
pJMP12089 Resource Report Resource Website |
RRID:Addgene_222357 | Hygromycin | PMID:39302127 | Tn7 expression vector. | Vector Backbone:R6Kγ; Vector Types:Bacterial Expression; Bacterial Resistance:Hygromycin | 2026-09-12 02:41:22 | 0 | |||
|
pSMT3-lpqZ-HA Resource Report Resource Website 1+ mentions |
RRID:Addgene_240159 | lpqZ | Mycobacterium marinum | Hygromycin | PMID:41384969 | Backbone Size:5720; Vector Backbone:pSMT3; Vector Types:Bacterial Expression; Bacterial Resistance:Hygromycin | 2026-09-12 02:45:28 | 1 | ||
|
pSMT3-fecB Resource Report Resource Website 1+ mentions |
RRID:Addgene_240158 | fecB (MMAR_1650) | Mycobacterium marinum | Hygromycin | PMID:41384969 | Vector Backbone:pSMT3; Vector Types:Bacterial Expression; Bacterial Resistance:Hygromycin | 2026-09-12 02:45:28 | 1 | ||
|
pAJF1124 Resource Report Resource Website |
RRID:Addgene_252904 | 3' rpoC(MSMEG_1368)-ALFA | Mycobacterium smegmatis MC2-155 | Hygromycin | PMID:40576343 | Vector Backbone:pAJF229; Vector Types:Bacterial Expression; Bacterial Resistance:Hygromycin | 2026-09-12 02:46:16 | 0 | ||
|
pEB multi-Hyg Human collagen type IV alpha 4 chain (COL4A4) Resource Report Resource Website |
RRID:Addgene_229771 | Human collagen type IV alpha 4 chain (COL4A4) | Homo sapiens | Hygromycin | PMID:29526710 | Backbone Marker:Fujifilm/Wako; Vector Backbone:pEBMulti-Hygro; Vector Types:Mammalian Expression; Bacterial Resistance:Hygromycin | 2026-09-12 02:43:19 | 0 | ||
|
pUMN105 Resource Report Resource Website |
RRID:Addgene_233024 | Hygromycin | PMID:41648453 | Please visit https://doi.org/10.64898/2026.01.22.701086 for bioRxiv preprint. | Backbone Size:2996; Vector Backbone:pUMN105; Vector Types:; Bacterial Resistance:Hygromycin | 2026-09-12 02:43:22 | 0 | |||
|
Ochre (rEcΔ2.ΔA.B3.tW*) Resource Report Resource Website |
RRID:Addgene_234622 | MG1655.ΔTAG.ΔTGA.ΔprfA.mprfB3.A37G-tRNA-Trp | n/a | Hygromycin | PMID:39910296 | Vector Backbone:n/a; Vector Types:This is a strain, not a plasmid; Bacterial Resistance:Hygromycin | 2026-09-12 02:43:47 | 0 | ||
|
pVITRO1-HAPPID1 Resource Report Resource Website 1+ mentions |
RRID:Addgene_204626 | HAPPID1 heavy chain | Homo sapiens | Hygromycin | PMID:37987253 | Backbone Marker:InvivoGen; Backbone Size:6441; Vector Backbone:pVITRO1-hygro-mcs; Vector Types:Mammalian Expression; Bacterial Resistance:Hygromycin | 2026-09-12 02:39:38 | 1 | ||
|
pCap-SG5-Hgy Resource Report Resource Website |
RRID:Addgene_227580 | Hygromycin | PMID:39666857 | Backbone Size:9915; Vector Backbone:pBAC2015, pGM1190, and pUC19; Vector Types:; Bacterial Resistance:Hygromycin | 2026-09-12 02:42:30 | 0 | ||||
|
pJMP10750_pCRISPRt-T-hyg Resource Report Resource Website |
RRID:Addgene_225843 | CRISPRt transposon with gRNA expression cassette (no guide) | Synthetic | Hygromycin | Please visit https://doi.org/10.1101/2024.03.01.582922 for bioRxiv preprint. | Vector Backbone:R6K_; Vector Types:Bacterial Expression, Synthetic Biology, CRISPR Associated Transposition (CAST); Bacterial Resistance:Hygromycin | 2026-09-12 02:47:14 | 0 | ||
|
PPE18-ALFA Resource Report Resource Website |
RRID:Addgene_231247 | PPE18-ALFA | Mycobacterium tuberculosis | Hygromycin | Backbone Marker:Bryson Lab; Backbone Size:6512; Vector Backbone:pBB115; Vector Types:Bacterial Expression; Bacterial Resistance:Hygromycin | 2026-09-12 02:43:02 | 0 | |||
|
PPE18-HA Resource Report Resource Website |
RRID:Addgene_231246 | PPE18-HA | Mycobacterium tuberculosis | Hygromycin | Backbone Size:6512; Vector Backbone:pBB115; Vector Types:Bacterial Expression; Bacterial Resistance:Hygromycin | 2026-09-12 02:43:02 | 0 | |||
|
C-5545 ∆cosδε Resource Report Resource Website |
RRID:Addgene_209018 | Deficient in the P2 bacteriophage packaging cos site; rhamnose-inducible P4 delta (δ) and epsilon (ε) genes | Escherichia coli | Hygromycin | PMID:33317264 | P2 bacteriophage lysogen derived from E. coli EMG C-5545 strain. We designed a pair of primers to check the presence of P2 lysogen in this strain: - P2 gpH C-ter gpG Fw: 5’ GCAGAGCACGAACAGTCACG 3’ - P2 gpH C-ter gpG Rv: 5’ TTATTGCGGCATTTCCGGCC 3’ These primers amplify the C-terminal region of the P2 gpH gene (tail fiber) and the complete gpG gene (tail fiber chaperone) (PCR fragment size: 2070 bp). | Vector Backbone:n/a; Vector Types:; Bacterial Resistance:Hygromycin | 2026-09-12 02:42:40 | 0 | |
|
pSt-KO Resource Report Resource Website |
RRID:Addgene_44566 | Hygromycin | PMID:23315736 | Backbone Size:4203; Vector Backbone:pVV16, pGOAL17; Vector Types:Bacterial Expression, E.coli-mycobacteria shuttle vector; Bacterial Resistance:Hygromycin | 2026-09-12 02:27:31 | 0 | ||||
|
pGMEH-T38M-750-luxAB-DAS+4 Resource Report Resource Website |
RRID:Addgene_49520 | T38M-P750-luxAB-DAS+4 | Other | Hygromycin | PMID:24191058 | Backbone Size:6465; Vector Backbone:pDE43-MEH; Vector Types:Bacterial Expression; Bacterial Resistance:Hygromycin | 2026-09-12 02:28:11 | 0 | ||
|
pGMEH-0X750-luxAB-DAS+4 Resource Report Resource Website |
RRID:Addgene_49519 | P750-luxAB-DAS+4 | Other | Hygromycin | PMID:24191058 | Backbone Size:6465; Vector Backbone:pDE43-MEH; Vector Types:Bacterial Expression; Bacterial Resistance:Hygromycin | 2026-09-12 02:28:11 | 0 | ||
|
pVITRO1-102.1F10-IgE/λ Resource Report Resource Website 1+ mentions |
RRID:Addgene_50365 | grass pollen allergen Phl p 7 specific human epsilon heavy chain expression cassette | Homo sapiens | Hygromycin | PMID:25073855 | Backbone Marker:InvivoGen; Backbone Size:6491; Vector Backbone:pVITRO1-hygro-mcs; Vector Types:Mammalian Expression; Bacterial Resistance:Hygromycin | 2026-09-12 02:28:16 | 1 |
Can't find your Plasmid?
We recommend that you click next to the search bar to check some helpful tips on searches and refine your search firstly. If you want to find a specific plasmid, it's easier to enter an RRID or an Addgene Catalog Number to search. You can refine the search results using Facets on the left side of the search results page. If you are on the table view, you can also search in a specific column by clicking the column title and enter the keywords.
If you still could not find your plasmid in the search results, please help us by registering it into the system — it's easy. Register it with Addgene.
Welcome to the NIF Resources search. From here you can search through a compilation of resources used by NIF and see how data is organized within our community.
You are currently on the Community Resources tab looking through categories and sources that NIF has compiled. You can navigate through those categories from here or change to a different tab to execute your search through. Each tab gives a different perspective on data.
If you have an account on NIF then you can log in from here to get additional features in NIF such as Collections, Saved Searches, and managing Resources.
Here is the search term that is being executed, you can type in anything you want to search for. Some tips to help searching:
If you are logged into NIF you can add data records to your collections to create custom spreadsheets across multiple sources of data.
Here are the facets that you can filter the data by.
If you have any further questions please check out our FAQs Page to ask questions and see our tutorials. Click this button to view this tutorial again.
Welcome to the Neuroscience Information Framework Project, designed to serve the biomedical research community. NIF maintains the largest searchable collection of neuroscience data, the largest catalog of biomedical resources, and the largest ontology for neuroscience on the web. We welcome all feedback and suggestions and are actively looking for resource providers to make their resources accessible through NIF. Learn about the tools available to help you share your data and discover a dynamic inventory of Web-based neuroscience resources.
