Searching the RRID Resource Information Network
Are you sure you want to leave this community? Leaving the community will revoke any permissions you have been granted in this community.
Species: E. coli
Genetic Insert: mCherry, Cas9, SgRNA
Vector Backbone Description: Backbone Size:3150; Vector Backbone:pSIP401 (spp-based expression) derivative, lacks spp-genes for induction; Vector Types:Bacterial Expression, CRISPR; Bacterial Resistance:Chloramphenicol
Defining Citation: PMID:39817779
Proper citation: RRID:Addgene_225428 Copy
Species: E. coli
Genetic Insert: EcSTH
Vector Backbone Description: Backbone Marker:Clontech; Backbone Size:9227; Vector Backbone:pLVX-TetOne-Puro; Vector Types:Mammalian Expression, Lentiviral, Synthetic Biology; Bacterial Resistance:Ampicillin
Defining Citation: PMID:37884806
Proper citation: RRID:Addgene_218628 Copy
Species: E. coli
Genetic Insert: ClbS from CFT073 (Codon optimized for E coli)
Vector Backbone Description: Backbone Marker:Thermofisher scientific; Backbone Size:4257; Vector Backbone:pTrcHis 2A; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:35197633
Proper citation: RRID:Addgene_223350 Copy
Species: E. coli
Genetic Insert: Genotype: F’[traD36 lacIq lacZ ∆M15 proA+B+] glnV (supE) thi-1 ∆(mcrB-hsdSM)5 (rK- mK- McrB-) ∆(lac-proAB) ulaD::M13
Vector Backbone Description: Vector Backbone:n/a; Vector Types:; Bacterial Resistance:None
Defining Citation: PMID:38499480
Comments: Primers for validation
Pair 1: agtaaggacgcgccatgaaa + agcgaaagacagcatcggaa (Ta = 59 C, should have 2526 bp product)
Pair 2: aatcggttgaatgtcgccct + gggaaacgacgatgagcaga (Ta = 59, should have 3900 bp product)
Proper citation: RRID:Addgene_220921 Copy
Species: E. coli
Genetic Insert: AsnRS
Vector Backbone Description: Vector Backbone:pET21a; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:40209036
Comments: It is best to grow cells in strains with LacIq and in media supplemented 1% glucose for genetic stability. Please visit https://doi.org/10.1101/2024.06.19.599772 for bioRxiv preprint.
Proper citation: RRID:Addgene_224363 Copy
Species: E. coli
Genetic Insert: PheRS
Vector Backbone Description: Vector Backbone:pET21a; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:40209036
Comments: It is best to grow cells in strains with LacIq and in media supplemented 1% glucose for genetic stability. Please visit https://doi.org/10.1101/2024.06.19.599772 for bioRxiv preprint.
Proper citation: RRID:Addgene_224364 Copy
Species: E. coli
Genetic Insert: IF2
Vector Backbone Description: Vector Backbone:pET21a; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:40209036
Comments: It is best to grow cells in strains with LacIq and in media supplemented 1% glucose for genetic stability. Please visit https://doi.org/10.1101/2024.06.19.599772 for bioRxiv preprint.
Proper citation: RRID:Addgene_224367 Copy
Species: E. coli
Genetic Insert: NDK
Vector Backbone Description: Vector Backbone:pET21a; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:40209036
Comments: It is best to grow cells in strains with LacIq and in media supplemented 1% glucose for genetic stability. Please visit https://doi.org/10.1101/2024.06.19.599772 for bioRxiv preprint.
Proper citation: RRID:Addgene_224376 Copy
Species: E. coli
Genetic Insert: RRF
Vector Backbone Description: Vector Backbone:pET21a; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:40209036
Comments: It is best to grow cells in strains with LacIq and in media supplemented 1% glucose for genetic stability. Please visit https://doi.org/10.1101/2024.06.19.599772 for bioRxiv preprint.
Proper citation: RRID:Addgene_224374 Copy
Species: E. coli
Genetic Insert: RF1
Vector Backbone Description: Vector Backbone:pET21a; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:40209036
Comments: It is best to grow cells in strains with LacIq and in media supplemented 1% glucose for genetic stability. Please visit https://doi.org/10.1101/2024.06.19.599772 for bioRxiv preprint.
Proper citation: RRID:Addgene_224372 Copy
Species: E. coli
Genetic Insert: EF-Tu
Vector Backbone Description: Vector Backbone:pET21a; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:40209036
Comments: It is best to grow cells in strains with LacIq and in media supplemented 1% glucose for genetic stability. Please visit https://doi.org/10.1101/2024.06.19.599772 for bioRxiv preprint.
Proper citation: RRID:Addgene_224370 Copy
Species: E. coli
Genetic Insert: EF-Ts
Vector Backbone Description: Vector Backbone:pET21a; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:40209036
Comments: It is best to grow cells in strains with LacIq and in media supplemented 1% glucose for genetic stability. Please visit https://doi.org/10.1101/2024.06.19.599772 for bioRxiv preprint.
Proper citation: RRID:Addgene_224371 Copy
Species: E. coli
Genetic Insert: VP64
Vector Backbone Description: Backbone Marker:Michael Bassik, Lacra Bintu, Addgene #161926; Vector Backbone:pJT126; Vector Types:Mammalian Expression, Lentiviral; Bacterial Resistance:Ampicillin
Defining Citation: PMID:39487265
Proper citation: RRID:Addgene_188758 Copy
Species: E. coli
Genetic Insert: CAR copy 1
Vector Backbone Description: Backbone Marker:Robertson; Backbone Size:2216; Vector Backbone:pAllet; Vector Types:Yeast Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:37345937
Proper citation: RRID:Addgene_203422 Copy
Species: E. coli
Genetic Insert: anti-GFP nanobody-Tn5 fusion
Vector Backbone Description: Backbone Size:6755; Vector Backbone:3XFlag-pA-Tn5-Fl; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin
Proper citation: RRID:Addgene_215567 Copy
Species: E. coli
Genetic Insert: SynZip18-Cascade
Vector Backbone Description: Backbone Size:2000; Vector Backbone:p15A; Vector Types:Bacterial Expression; Bacterial Resistance:Chloramphenicol
Defining Citation: PMID:35077145
Proper citation: RRID:Addgene_182955 Copy
Species: E. coli
Genetic Insert: MsbA
Vector Backbone Description: Backbone Marker:Novagen; Backbone Size:3429; Vector Backbone:pCDF-Duet-1; Vector Types:Bacterial Expression; Bacterial Resistance:Spectinomycin
Defining Citation: PMID:36435815
Proper citation: RRID:Addgene_191476 Copy
Species: E. coli
Genetic Insert: EcTrpRS
Vector Backbone Description: Vector Backbone:pAcBac3; Vector Types:Mammalian Expression, Baculoviral; Bacterial Resistance:Ampicillin
Defining Citation: PMID:36905325
Proper citation: RRID:Addgene_228786 Copy
Species: E. coli
Genetic Insert: EcTyrRS
Vector Backbone Description: Vector Backbone:pAcBac3; Vector Types:Mammalian Expression, Baculoviral; Bacterial Resistance:Ampicillin
Defining Citation: PMID:36905325
Proper citation: RRID:Addgene_228787 Copy
Species: E. coli
Genetic Insert: RssB
Vector Backbone Description: Backbone Size:5387; Vector Backbone:pSY5; Vector Types:Bacterial Expression; Bacterial Resistance:Kanamycin
Defining Citation: PMID:30975721
Proper citation: RRID:Addgene_229464 Copy
Can't find your Plasmid?
We recommend that you click next to the search bar to check some helpful tips on searches and refine your search firstly. If you want to find a specific plasmid, it's easier to enter an RRID or an Addgene Catalog Number to search. You can refine the search results using Facets on the left side of the search results page. If you are on the table view, you can also search in a specific column by clicking the column title and enter the keywords.
If you still could not find your plasmid in the search results, please help us by registering it into the system — it's easy. Register it with Addgene.
Welcome to the NIF Resources search. From here you can search through a compilation of resources used by NIF and see how data is organized within our community.
You are currently on the Community Resources tab looking through categories and sources that NIF has compiled. You can navigate through those categories from here or change to a different tab to execute your search through. Each tab gives a different perspective on data.
If you have an account on NIF then you can log in from here to get additional features in NIF such as Collections, Saved Searches, and managing Resources.
Here is the search term that is being executed, you can type in anything you want to search for. Some tips to help searching:
You can save any searches you perform for quick access to later from here.
We recognized your search term and included synonyms and inferred terms along side your term to help get the data you are looking for.
If you are logged into NIF you can add data records to your collections to create custom spreadsheets across multiple sources of data.
Here are the sources that were queried against in your search that you can investigate further.
Here are the categories present within NIF that you can filter your data on
Here are the subcategories present within this category that you can filter your data on
If you have any further questions please check out our FAQs Page to ask questions and see our tutorials. Click this button to view this tutorial again.
Welcome to the Neuroscience Information Framework Project, designed to serve the biomedical research community. NIF maintains the largest searchable collection of neuroscience data, the largest catalog of biomedical resources, and the largest ontology for neuroscience on the web. We welcome all feedback and suggestions and are actively looking for resource providers to make their resources accessible through NIF. Learn about the tools available to help you share your data and discover a dynamic inventory of Web-based neuroscience resources.
