Searching the RRID Resource Information Network
Are you sure you want to leave this community? Leaving the community will revoke any permissions you have been granted in this community.
Species: Other
Genetic Insert: CAG-LSL-dCas9-10xGCN4-P2A-scFv-P65-HSF1-T2A-EGFP-WPRE-PolyA
Vector Backbone Description: Vector Backbone:PB; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin and Kanamycin
References:
Comments:
Proper citation: RRID:Addgene_107307 Copy
Species: Saccharomyces cerevisiae
Genetic Insert: rDNA NTS
Vector Backbone Description: Backbone Marker:Invitrogen; Backbone Size:4000; Vector Backbone:pTOPO; Vector Types:Bacterial Cloning - TOPO; Bacterial Resistance:Ampicillin and Kanamycin
References:
Comments:
Proper citation: RRID:Addgene_23992 Copy
Species: Mus musculus
Genetic Insert: Tbx20
Vector Backbone Description: Backbone Size:3900; Vector Backbone:pCRII-TOPO; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin and Kanamycin
References:
Comments: Mouse Tbx20 from e12.5 mouse heart cDNA was isolated by PCR.
Proper citation: RRID:Addgene_24715 Copy
Species: maize (corn)
Genetic Insert: zmU3 promoter - gRNA
Vector Backbone Description: Backbone Marker:Transgen; Backbone Size:3929; Vector Backbone:pEasy-blunt; Vector Types:CRISPR, Plant expression; Bacterial Resistance:Ampicillin and Kanamycin
References:
Comments:
Proper citation: RRID:Addgene_53061 Copy
Species: Synthetic
Genetic Insert: Actb MMEJ donor
Vector Backbone Description: Vector Backbone:pAAV; Vector Types:Mammalian Expression, Mouse Targeting, AAV; Bacterial Resistance:Ampicillin and Kanamycin
References:
Comments: gRNA sequence: agtccgcctagaagcacttg
Proper citation: RRID:Addgene_97315 Copy
Species: Synthetic
Genetic Insert: Actb NHEJ donor
Vector Backbone Description: Vector Backbone:pAAV; Vector Types:Mammalian Expression, Mouse Targeting, AAV; Bacterial Resistance:Ampicillin and Kanamycin
References:
Comments: gRNA sequence: agtccgcctagaagcacttg
Proper citation: RRID:Addgene_97316 Copy
Species: Synthetic
Genetic Insert: Cdx2 HMEJ donor
Vector Backbone Description: Vector Backbone:pAAV; Vector Types:Mammalian Expression, Mouse Targeting, AAV; Bacterial Resistance:Ampicillin and Kanamycin
References:
Comments: gRNA sequence: agaccacgggaggggtcact
Proper citation: RRID:Addgene_97319 Copy
Species: Synthetic
Genetic Insert: Nanog HMEJ donor
Vector Backbone Description: Vector Backbone:pAAV; Vector Types:Mammalian Expression, Mouse Targeting, AAV; Bacterial Resistance:Ampicillin and Kanamycin
References:
Comments: gRNA sequence: cgtaagtctcatatttcacc
Proper citation: RRID:Addgene_97321 Copy
Species: Synthetic
Genetic Insert: Sox2 HMEJ donor
Vector Backbone Description: Vector Backbone:pAAV; Vector Types:Mammalian Expression, Mouse Targeting, AAV; Bacterial Resistance:Ampicillin and Kanamycin
References:
Comments: gRNA sequence: tgcccctgtcgcacatgtga
Proper citation: RRID:Addgene_97322 Copy
Species: Synthetic
Genetic Insert: gRNA PCR template
Vector Backbone Description: Backbone Marker:TransGen Biotech; Vector Backbone:pEASY-blunt; Vector Types:Yeast Expression, CRISPR; Bacterial Resistance:Ampicillin and Kanamycin
References:
Comments: These plasmids are used for a cloning-free method of CRISPR/Cas9-mediated genome editing in fission yeast. This method takes advantage of gap repair in fission yeast cells to assemble two linear DNA fragments, a gapped Cas9-encoding plasmid and a PCR-amplified gRNA insert, into a circular plasmid. To reduce non-specific gap repair background, we adopt a split-marker strategy. pDB4280 and pDB4282 serve as the source of the gapped plasmid and the PCR template for gRNA insert amplification, respectively, in the split-ura4 system. pDB4281 and pDB4283 serve the same purposes for the split-bsdMX system. pDB4279 is a transformation control for the split-bsdMX system.
Proper citation: RRID:Addgene_98701 Copy
Species: Synthetic
Genetic Insert: gRNA PCR template
Vector Backbone Description: Backbone Marker:TransGen Biotech; Vector Backbone:pEASY-blunt; Vector Types:Yeast Expression, CRISPR; Bacterial Resistance:Ampicillin and Kanamycin
References:
Comments: These plasmids are used for a cloning-free method of CRISPR/Cas9-mediated genome editing in fission yeast. This method takes advantage of gap repair in fission yeast cells to assemble two linear DNA fragments, a gapped Cas9-encoding plasmid and a PCR-amplified gRNA insert, into a circular plasmid. To reduce non-specific gap repair background, we adopt a split-marker strategy. pDB4280 and pDB4282 serve as the source of the gapped plasmid and the PCR template for gRNA insert amplification, respectively, in the split-ura4 system. pDB4281 and pDB4283 serve the same purposes for the split-bsdMX system. pDB4279 is a transformation control for the split-bsdMX system.
Proper citation: RRID:Addgene_98702 Copy
Species: Schmidtea mediterranea
Genetic Insert: mblk in situ probe
Vector Backbone Description: Backbone Marker:Phillip Newmark (Addgene plasmid # 26536); Backbone Size:3240; Vector Backbone:pJC53.2; Vector Types:T/A Cloning Vector for dsRNA generation and the generation of sense and anti-sense probes; Bacterial Resistance:Ampicillin and Kanamycin
References:
Comments: Cloning primers: F-CGTGCTCGTGAGAATTGTTG, R-AGTACGCAGCAGAGGCAAGT
Proper citation: RRID:Addgene_99091 Copy
Species: Schmidtea mediterranea
Genetic Insert: GluR1 (Glutamate receptor 1) in situ probe
Vector Backbone Description: Backbone Marker:Phillip Newmark (Addgene plasmid # 26536); Backbone Size:3240; Vector Backbone:pJC53.2; Vector Types:T/A Cloning Vector for dsRNA generation and the generation of sense and anti-sense probes; Bacterial Resistance:Ampicillin and Kanamycin
References:
Comments: Cloning primers: F-GTTATCGGAAGCGACGACAT, R-TGGATGACACCGAGCTATTG
Proper citation: RRID:Addgene_99070 Copy
Species: Schmidtea mediterranea
Genetic Insert: Ndk (nou darake) in situ probe
Vector Backbone Description: Backbone Marker:Phillip Newmark (Addgene plasmid # 26536); Backbone Size:3240; Vector Backbone:pJC53.2; Vector Types:T/A Cloning Vector for dsRNA generation and the generation of sense and anti-sense probes; Bacterial Resistance:Ampicillin and Kanamycin
References:
Comments: Cloning primers: F-atcgacatatgacaataccgattgtcaaacccttc, R-atcgaggatccttaggccttaactccaattatatc;also has Nde1/BamHI sites for subcloning
Proper citation: RRID:Addgene_99072 Copy
Species: Schmidtea mediterranea
Genetic Insert: Bmp4 (also known as bmp) in situ probe
Vector Backbone Description: Backbone Marker:Phillip Newmark (Addgene plasmid # 26536); Backbone Size:3240; Vector Backbone:pJC53.2; Vector Types:T/A Cloning Vector for dsRNA generation and the generation of sense and anti-sense probes; Bacterial Resistance:Ampicillin and Kanamycin
References:
Comments: Cloning primers: F-CGGATTTTGGAGGAATAGGTC, R-TCTGGGCGTAAATTGTAGGG
Proper citation: RRID:Addgene_99076 Copy
Species: Schmidtea mediterranea
Genetic Insert: ActR1 (activin receptor 1) in situ probe
Vector Backbone Description: Backbone Marker:Phillip Newmark (Addgene plasmid # 26536); Backbone Size:3240; Vector Backbone:pJC53.2; Vector Types:T/A Cloning Vector for dsRNA generation and the generation of sense and anti-sense probes; Bacterial Resistance:Ampicillin and Kanamycin
References:
Comments: Cloning primers: F-GCTGGCTCTTCAAACCAAGA, R-GGTAAACCTGGAATCGCTCA
Proper citation: RRID:Addgene_99077 Copy
Species: Schmidtea mediterranea
Genetic Insert: h.72.4d in situ probe
Vector Backbone Description: Backbone Marker:Phillip Newmark (Addgene plasmid # 26536); Backbone Size:3240; Vector Backbone:pJC53.2; Vector Types:T/A Cloning Vector for dsRNA generation and the generation of sense and anti-sense probes; Bacterial Resistance:Ampicillin and Kanamycin
References:
Comments: Cloning primers: F-TTTTTGATTTGTAACTTTGTTCTTGA, R-CAATGAATCAATAGAATGTGGAAT
Proper citation: RRID:Addgene_99080 Copy
Species: Schmidtea mediterranea
Genetic Insert: MCP (also known as h.45.8g) in situ probe
Vector Backbone Description: Backbone Marker:Phillip Newmark (Addgene plasmid # 26536); Backbone Size:3240; Vector Backbone:pJC53.2; Vector Types:T/A Cloning Vector for dsRNA generation and the generation of sense and anti-sense probes; Bacterial Resistance:Ampicillin and Kanamycin
References:
Comments: Cloning primers: F-CCAACAAGGCTTTTTATTATTTATG, R-GAAATGATGGCATAGGAGGTC
Proper citation: RRID:Addgene_99083 Copy
Species: Schmidtea mediterranea
Genetic Insert: nemo-like kinase (also known as h.109.4e) in situ probe
Vector Backbone Description: Backbone Marker:Phillip Newmark (Addgene plasmid # 26536); Backbone Size:3240; Vector Backbone:pJC53.2; Vector Types:T/A Cloning Vector for dsRNA generation and the generation of sense and anti-sense probes; Bacterial Resistance:Ampicillin and Kanamycin
References:
Comments: Cloning primers: F-CAAATGGTTGTTACGCTCCA R-GACATGGTCGACTGACAACG
Proper citation: RRID:Addgene_99082 Copy
Species: Schmidtea mediterranea
Genetic Insert: Unc-9 (also known as h.26.12f) in situ probe
Vector Backbone Description: Backbone Marker:Phillip Newmark (Addgene plasmid # 26536); Backbone Size:3240; Vector Backbone:pJC53.2; Vector Types:T/A Cloning Vector for dsRNA generation and the generation of sense and anti-sense probes; Bacterial Resistance:Ampicillin and Kanamycin
References:
Comments: Cloning primers: F-TGTAGCTTTTTCCGGGAATTT, R-TACAATGCGTATTGCCGTTG
Proper citation: RRID:Addgene_99084 Copy
Can't find your Plasmid?
We recommend that you click next to the search bar to check some helpful tips on searches and refine your search firstly. If you want to find a specific plasmid, it's easier to enter an RRID or an Addgene Catalog Number to search. You can refine the search results using Facets on the left side of the search results page. If you are on the table view, you can also search in a specific column by clicking the column title and enter the keywords.
If you still could not find your plasmid in the search results, please help us by registering it into the system — it's easy. Register it with Addgene.
Welcome to the NIF Resources search. From here you can search through a compilation of resources used by NIF and see how data is organized within our community.
You are currently on the Community Resources tab looking through categories and sources that NIF has compiled. You can navigate through those categories from here or change to a different tab to execute your search through. Each tab gives a different perspective on data.
If you have an account on NIF then you can log in from here to get additional features in NIF such as Collections, Saved Searches, and managing Resources.
Here is the search term that is being executed, you can type in anything you want to search for. Some tips to help searching:
You can save any searches you perform for quick access to later from here.
We recognized your search term and included synonyms and inferred terms along side your term to help get the data you are looking for.
If you are logged into NIF you can add data records to your collections to create custom spreadsheets across multiple sources of data.
Here are the sources that were queried against in your search that you can investigate further.
Here are the categories present within NIF that you can filter your data on
Here are the subcategories present within this category that you can filter your data on
If you have any further questions please check out our FAQs Page to ask questions and see our tutorials. Click this button to view this tutorial again.
Welcome to the Neuroscience Information Framework Project, designed to serve the biomedical research community. NIF maintains the largest searchable collection of neuroscience data, the largest catalog of biomedical resources, and the largest ontology for neuroscience on the web. We welcome all feedback and suggestions and are actively looking for resource providers to make their resources accessible through NIF. Learn about the tools available to help you share your data and discover a dynamic inventory of Web-based neuroscience resources.
