Plasmids   Select Another Resource Report Type

http://www.addgene.org/46168

Species: Synthetic
Genetic Insert: codon optimized Cas9_SV40 NLS with intron
Vector Backbone Description: Backbone Size:2641; Vector Backbone:pUC57; Vector Types:CRISPR; Bacterial Resistance:Ampicillin
Defining Citation: PMID:23817069
Comments: Please note: eft-3 has officially been changed to eef-1A.1 Please see the eef-1A.1 WormBase entry for details: http://www.wormbase.org/species/c_elegans/gene/WBGene00001168#05-9g-3

Proper citation: RRID:Addgene_46168 Copy   

•   Source: Addgene

http://www.addgene.org/46162

Vector Backbone Description: Backbone Size:9909; Vector Backbone:pUASp; Vector Types:Insect Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:27694947

Proper citation: RRID:Addgene_46162 Copy   

•   Source: Addgene

http://www.addgene.org/46164

Species: Mus musculus
Genetic Insert: mCD8mCherry
Vector Backbone Description: Backbone Size:9929; Vector Backbone:pQUASp; Vector Types:Insect Expression; Bacterial Resistance:Ampicillin

Proper citation: RRID:Addgene_46164 Copy   

•   Source: Addgene

http://www.addgene.org/46145

Vector Backbone Description: Backbone Marker:Gerry Rubin; Backbone Size:8151; Vector Backbone:pJFRC-7; Vector Types:Insect Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:23817068

Proper citation: RRID:Addgene_46145 Copy   

•   Source: Addgene

http://www.addgene.org/46140

Genetic Insert: mCherry
Vector Backbone Description: Backbone Marker:stratagene; Vector Backbone:pBluescript II KS+; Vector Types:Cre/Lox, mutagenic gene trap for zebrafish; Bacterial Resistance:Ampicillin
Defining Citation: PMID:22908272
Comments: mCherry is in the "+2" reading frame starting from the exon. This is a Tol2-based FlExTrap vector. It consists of a highly mutagenic gene trap contained within the FlEx cassette that can be stably inverted by both Cre and Flp recombinases. FRT/F3 and loxP/lox5171 are incompatible recombination sites used for the Flp and Cre recombinases, respectively, to stably invert the cassette. The reporter gene, mCherry, has its own initiation codon.

Proper citation: RRID:Addgene_46140 Copy   

•   Source: Addgene

http://www.addgene.org/46144

Genetic Insert: EGFP/mCherry
Vector Backbone Description: Backbone Marker:stratagene; Vector Backbone:pBluescript II KS+; Vector Types:Cre/Lox, Tol2 zebrafish transgenic expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:19415631
Comments: This plasmid can be used to make a transgene that expresses EGFP but can be switched to express mCherry if inverted. This reporter is controlled by a 2.3 kb regulatory sequence consisting of 0.2 kb Xenopus EF1alpha enhancer and 2.1 kb zebrafish beta-actin 2 sequence including the 1.5 kb enhancer/promoter sequence, the 1st exon (86 bp) and part of the 1st intron (490 bp). To generate a complete intron, the splice acceptor from the rabbit beta-globin gene was placed upstream of the EGFP reporter and a synthetic splice acceptor was placed upstream of the mCherry reporter. The synthetic splice acceptor contains the zebrafish consensus sequence along with intronic and exonic splice enhancers. There are some discrepancies between Addgene's and the depositor's sequence--these do not affect plasmid function.

Proper citation: RRID:Addgene_46144 Copy   

•   Source: Addgene

http://www.addgene.org/46136

Species: Synthetic
Genetic Insert: QF#7
Vector Backbone Description: Backbone Size:5176; Vector Backbone:pPTGAL4; Vector Types:Insect Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:25581800
Comments: Please see this additional reference https://www.ncbi.nlm.nih.gov/pubmed/20434990 for more information on the Q-system.

Proper citation: RRID:Addgene_46136 Copy   

•   Source: Addgene

http://www.addgene.org/46137

Species: Saccharomyces cerevisiae
Genetic Insert: GAL80
Vector Backbone Description: Backbone Size:8938; Vector Backbone:pQUAST; Vector Types:Insect Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:25581800
Comments: Please see this additional reference https://www.ncbi.nlm.nih.gov/pubmed/20434990 for more information on the Q-system.

Proper citation: RRID:Addgene_46137 Copy   

•   Source: Addgene

http://www.addgene.org/46138

Genetic Insert: mCherry
Vector Backbone Description: Backbone Marker:stratagene; Vector Backbone:pBluescript II KS+; Vector Types:Cre/Lox, mutagenic gene trap for zebrafish; Bacterial Resistance:Ampicillin
Defining Citation: PMID:22908272
Comments: mCherry is in the "even" or "0" reading frame starting from the exon. This is a Tol2-based FlExTrap vector. It consists of a highly mutagenic gene trap contained within the FlEx cassette that can be stably inverted by both Cre and Flp recombinases. FRT/F3 and loxP/lox5171 are incompatible recombination sites used for the Flp and Cre recombinases, respectively, to stably invert the cassette. The reporter gene, mCherry, has its own initiation codon.

Proper citation: RRID:Addgene_46138 Copy   

•   Source: Addgene

http://www.addgene.org/46139

Genetic Insert: mCherry
Vector Backbone Description: Backbone Marker:stratagene; Vector Backbone:pBluescript II KS+; Vector Types:Cre/Lox, mutagenic gene trap for zebrafish; Bacterial Resistance:Ampicillin
Defining Citation: PMID:22908272
Comments: mCherry is in the "+1" reading frame starting from the exon. This is a Tol2-based FlExTrap vector. It consists of a highly mutagenic gene trap contained within the FlEx cassette that can be stably inverted by both Cre and Flp recombinases. FRT/F3 and loxP/lox5171 are incompatible recombination sites used for the Flp and Cre recombinases, respectively, to stably invert the cassette. The reporter gene, mCherry, has its own initiation codon.

Proper citation: RRID:Addgene_46139 Copy   

•   Source: Addgene

http://www.addgene.org/46132

Species: Synthetic
Genetic Insert: QSco
Vector Backbone Description: Backbone Size:11431; Vector Backbone:pCasper4-tubulinP; Vector Types:Insect Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:25581800
Comments: Please note that Addgene's sequencing results found a single nucleotide mismatch at bp# 5036 in the tubulin promoter when compared to the full plasmid sequence. The depositing laboratory states that this difference is not a concern for the function of the plasmid. Please see this additional reference https://www.ncbi.nlm.nih.gov/pubmed/20434990 for more information on the Q-system.

Proper citation: RRID:Addgene_46132 Copy   

•   Source: Addgene

http://www.addgene.org/46091

Species: Synthetic
Genetic Insert: G4BDMD-QFAD
Vector Backbone Description: Backbone Size:6445; Vector Backbone:pPAC5C-PL; Vector Types:Insect Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:25581800
Comments: Please see this additional reference https://www.ncbi.nlm.nih.gov/pubmed/20434990 for more information on the Q-system.

Proper citation: RRID:Addgene_46091 Copy   

•   Source: Addgene

http://www.addgene.org/46125

Species: Synthetic
Genetic Insert: QF#7
Vector Backbone Description: Backbone Size:11271; Vector Backbone:pCaSpeR-act5cB; Vector Types:Insect Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:25581800
Comments: Please note that Addgene's sequencing results found a few mismatches/gaps in the actin5c promoter when compared to the full plasmid sequence. The depositing laboratory states that this difference is not a concern for the function of the plasmid. Please see this additional reference https://www.ncbi.nlm.nih.gov/pubmed/20434990 for more information on the Q-system.

Proper citation: RRID:Addgene_46125 Copy   

•   Source: Addgene

http://www.addgene.org/46126

Species: Synthetic
Genetic Insert: QF#7m1
Vector Backbone Description: Backbone Size:11271; Vector Backbone:pCaSpeR-act5cB; Vector Types:Insect Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:25581800
Comments: Please note that Addgene's sequencing results found a few mismatches/gaps in the actin5c promoter when compared to the full plasmid sequence. The depositing laboratory states that this difference is not a concern for the function of the plasmid. Please see this additional reference https://www.ncbi.nlm.nih.gov/pubmed/20434990 for more information on the Q-system.

Proper citation: RRID:Addgene_46126 Copy   

•   Source: Addgene

http://www.addgene.org/46123

Species: Synthetic
Genetic Insert: LexA-QF
Vector Backbone Description: Backbone Size:7400; Vector Backbone:pattB; Vector Types:Insect Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:25581800
Comments: Please see this additional reference https://www.ncbi.nlm.nih.gov/pubmed/20434990 for more information on the Q-system.

Proper citation: RRID:Addgene_46123 Copy   

•   Source: Addgene

http://www.addgene.org/46128

Species: Synthetic
Genetic Insert: QF#7m1
Vector Backbone Description: Backbone Size:7743; Vector Backbone:pCaSpeR4; Vector Types:Insect Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:25581800
Comments: Please see this additional reference https://www.ncbi.nlm.nih.gov/pubmed/20434990 for more information on the Q-system.

Proper citation: RRID:Addgene_46128 Copy   

•   Source: Addgene

http://www.addgene.org/46085

Genetic Insert: DR-GFPuniv reporter
Vector Backbone Description: Backbone Marker:Jasin Lab (Addgene Plasmid# 26475); Vector Backbone:pDR-GFP; Vector Types:Mammalian Expression, recombination reporter plasmid; Bacterial Resistance:Ampicillin
Defining Citation: PMID:22121229
Comments: Description: Plasmid for in vivo recombination assays. Based on the original pDR-GFP plasmid described in Pierce et al. GenDev (1999) v13p2633. Use data: Recipient plasmid for (homing) endonuclease target sites in order to assess in vivo activity of an endonuclease. The plasmid contains two non-functional copies of the eGFP gene: the 5’ copy is interrupted by the target site of interest and stop codons; the 3’ copy is truncated on both 5’- and 3’-end. pDR-GFP as is does not fulfill any other purpose than to receive (homing) endonuclease target sites. The recognition site for the endonuclease of interest must be cloned into the XhoI/SacI sites in the upstream eGFP gene, thus obliterating the XhoI, KpnI and SacI sites. Successful cleavage of the cloned target site generates a DSB. This triggers in vivo a homologous recombination event with the 3’ truncated copy of the eGFP which renders the 5’ copy functional. The activity of a given endonuclease can be measured by the number of GFP+ cells generated. The site that is cloned into pDR-GFP must insert a frameshift into the 5’ eGFP-copy and/or contain a stop codon in frame with the upstream sequence of the eGFP gene to assure that the ORF is not functional and no eGFP can be synthesized prior to the DSB repair event. In order to easily screen for the successful insertion of the oligonucleotide pair representing the site of interest, it is useful to integrate a restriction site that is not present in pDR-GFPuniv (e.g. a PvuII site). Sample oligonucleotide pair: oligo1 5’-TCGATAGGGATAACAGGGTAATACAGCTGTAAGCT-3’ oligo2 3’- ATCCCTATTGTCCCATTATGTCGACAT -5’ Please note that this plasmid functions as described in the associated publication and according to the depositing laboratory the changes to the EGFP sequence are not a concern.

Proper citation: RRID:Addgene_46085 Copy   

•   Source: Addgene

http://www.addgene.org/46121

Species: Synthetic
Genetic Insert: QFBDAD-G4MD50-761
Vector Backbone Description: Backbone Size:7400; Vector Backbone:pattB; Vector Types:Insect Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:25581800
Comments: Please see this additional reference https://www.ncbi.nlm.nih.gov/pubmed/20434990 for more information on the Q-system.

Proper citation: RRID:Addgene_46121 Copy   

•   Source: Addgene

http://www.addgene.org/46089

Species: Synthetic
Genetic Insert: QFrco
Vector Backbone Description: Backbone Size:6445; Vector Backbone:pPAC5C-PL; Vector Types:; Bacterial Resistance:Ampicillin
Defining Citation: PMID:25581800
Comments: Please see this additional reference https://www.ncbi.nlm.nih.gov/pubmed/20434990 for more information on the Q-system.

Proper citation: RRID:Addgene_46089 Copy   

•   Source: Addgene

http://www.addgene.org/46122

Species: Synthetic
Genetic Insert: QFBDAD-G4MD257-761
Vector Backbone Description: Backbone Size:7400; Vector Backbone:pattB; Vector Types:Insect Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:25581800
Comments: Please see this additional reference https://www.ncbi.nlm.nih.gov/pubmed/20434990 for more information on the Q-system.

Proper citation: RRID:Addgene_46122 Copy   

•   Source: Addgene