Searching the RRID Resource Information Network
Are you sure you want to leave this community? Leaving the community will revoke any permissions you have been granted in this community.
| Plasmid Name | Proper Citation | Insert Name | Organism | Bacterial Resistance | Defining Citation |
Comments |
||||
|---|---|---|---|---|---|---|---|---|---|---|
|
LSB-hsa-miR-767-3p Resource Report Resource Website |
RRID:Addgene_103733 | hsa-miR-767-3p target | Homo sapiens | Ampicillin and Kanamycin | PMID:29934631 | Please note that this plasmid is inherently unstable due to a repeating poly A element. We recommend performing a diagnostic digest on multiple colonies upon receipt. The depositors would like to note the presence of several discrepancies between the depositor sequence and physical plasmid sequence. In particular, the sequences upstream and downstream of the puromycin coding region have 10 bp insertions which do not affect the ability to perform puromycin selection. The sequences for those regions within the physical plasmids are as follows: Upstream of Puro: GAATTCGACCGCCTGTCTCAAGGTGCCACC; Downstream of Puro: GCTTTGAGACTACGCGTGAATTCACTCCTC. Please contact [email protected] if you are interested in this plasmid prior to placing an order. | Vector Backbone:Low Sensor Backbone (LSB); Vector Types:Mammalian Expression, Synthetic Biology; Bacterial Resistance:Ampicillin and Kanamycin | 2026-07-25 12:34:00 | 0 | |
|
LSB-hsa-miR-766-5p Resource Report Resource Website |
RRID:Addgene_103732 | hsa-miR-766-5p target | Homo sapiens | Ampicillin and Kanamycin | PMID:29934631 | Please note that this plasmid is inherently unstable due to a repeating poly A element. We recommend performing a diagnostic digest on multiple colonies upon receipt. The depositors would like to note the presence of several discrepancies between the depositor sequence and physical plasmid sequence. In particular, the sequences upstream and downstream of the puromycin coding region have 10 bp insertions which do not affect the ability to perform puromycin selection. The sequences for those regions within the physical plasmids are as follows: Upstream of Puro: GAATTCGACCGCCTGTCTCAAGGTGCCACC; Downstream of Puro: GCTTTGAGACTACGCGTGAATTCACTCCTC. Please contact [email protected] if you are interested in this plasmid prior to placing an order. | Vector Backbone:Low Sensor Backbone (LSB); Vector Types:Mammalian Expression, Synthetic Biology; Bacterial Resistance:Ampicillin and Kanamycin | 2026-07-25 12:34:00 | 0 | |
|
LSB-hsa-miR-887-3p Resource Report Resource Website |
RRID:Addgene_103746 | hsa-miR-887-3p target | Homo sapiens | Ampicillin and Kanamycin | PMID:29934631 | Please note that this plasmid is inherently unstable due to a repeating poly A element. We recommend performing a diagnostic digest on multiple colonies upon receipt. The depositors would like to note the presence of several discrepancies between the depositor sequence and physical plasmid sequence. In particular, the sequences upstream and downstream of the puromycin coding region have 10 bp insertions which do not affect the ability to perform puromycin selection. The sequences for those regions within the physical plasmids are as follows: Upstream of Puro: GAATTCGACCGCCTGTCTCAAGGTGCCACC; Downstream of Puro: GCTTTGAGACTACGCGTGAATTCACTCCTC. Please contact [email protected] if you are interested in this plasmid prior to placing an order. | Vector Backbone:Low Sensor Backbone (LSB); Vector Types:Mammalian Expression, Synthetic Biology; Bacterial Resistance:Ampicillin and Kanamycin | 2026-07-25 12:34:01 | 0 | |
|
LSB-hsa-miR-885-3p Resource Report Resource Website |
RRID:Addgene_103744 | hsa-miR-885-3p target | Homo sapiens | Ampicillin and Kanamycin | PMID:29934631 | Please note that this plasmid is inherently unstable due to a repeating poly A element. We recommend performing a diagnostic digest on multiple colonies upon receipt. The depositors would like to note the presence of several discrepancies between the depositor sequence and physical plasmid sequence. In particular, the sequences upstream and downstream of the puromycin coding region have 10 bp insertions which do not affect the ability to perform puromycin selection. The sequences for those regions within the physical plasmids are as follows: Upstream of Puro: GAATTCGACCGCCTGTCTCAAGGTGCCACC; Downstream of Puro: GCTTTGAGACTACGCGTGAATTCACTCCTC. Please contact [email protected] if you are interested in this plasmid prior to placing an order. | Vector Backbone:Low Sensor Backbone (LSB); Vector Types:Mammalian Expression, Synthetic Biology; Bacterial Resistance:Ampicillin and Kanamycin | 2026-07-25 12:34:01 | 0 | |
|
LSB-hsa-miR-708-3p Resource Report Resource Website |
RRID:Addgene_103724 | hsa-miR-708-3p target | Homo sapiens | Ampicillin and Kanamycin | PMID:29934631 | Please note that this plasmid is inherently unstable due to a repeating poly A element. We recommend performing a diagnostic digest on multiple colonies upon receipt. The depositors would like to note the presence of several discrepancies between the depositor sequence and physical plasmid sequence. In particular, the sequences upstream and downstream of the puromycin coding region have 10 bp insertions which do not affect the ability to perform puromycin selection. The sequences for those regions within the physical plasmids are as follows: Upstream of Puro: GAATTCGACCGCCTGTCTCAAGGTGCCACC; Downstream of Puro: GCTTTGAGACTACGCGTGAATTCACTCCTC. Please contact [email protected] if you are interested in this plasmid prior to placing an order. | Vector Backbone:Low Sensor Backbone (LSB); Vector Types:Mammalian Expression, Synthetic Biology; Bacterial Resistance:Ampicillin and Kanamycin | 2026-07-25 12:34:00 | 0 | |
|
LSB-hsa-miR-7-5p Resource Report Resource Website |
RRID:Addgene_103723 | hsa-miR-7-5p target | Homo sapiens | Ampicillin and Kanamycin | PMID:29934631 | Please note that this plasmid is inherently unstable due to a repeating poly A element. We recommend performing a diagnostic digest on multiple colonies upon receipt. The depositors would like to note the presence of several discrepancies between the depositor sequence and physical plasmid sequence. In particular, the sequences upstream and downstream of the puromycin coding region have 10 bp insertions which do not affect the ability to perform puromycin selection. The sequences for those regions within the physical plasmids are as follows: Upstream of Puro: GAATTCGACCGCCTGTCTCAAGGTGCCACC; Downstream of Puro: GCTTTGAGACTACGCGTGAATTCACTCCTC. Please contact [email protected] if you are interested in this plasmid prior to placing an order. | Vector Backbone:Low Sensor Backbone (LSB); Vector Types:Mammalian Expression, Synthetic Biology; Bacterial Resistance:Ampicillin and Kanamycin | 2026-07-25 12:34:00 | 0 | |
|
pSaGuide Resource Report Resource Website 1+ mentions |
RRID:Addgene_64710 | Staphylococcus aureus guide RNA | Synthetic | Ampicillin and Kanamycin | Backbone Marker:Invitrogen; Backbone Size:3931; Vector Backbone:pCR2.1-TOPO; Vector Types:Mammalian Expression, CRISPR; Bacterial Resistance:Ampicillin and Kanamycin | 2026-07-25 12:50:02 | 2 | |||
|
TC9nickpAB Resource Report Resource Website |
RRID:Addgene_71311 | Cas9 nickase | S. pyogenes | Ampicillin and Kanamycin | The poly A tail included in the sequence is sufficient for purification of full length transcript using an oligo dT column. This decreases the amount of incomplete transcripts (and therefore decreases truncated Cas9 proteins). | Backbone Marker:Thermo-Fisher; Backbone Size:3900; Vector Backbone:PCR2-1 TOPO; Vector Types:in vitro transcription; Bacterial Resistance:Ampicillin and Kanamycin | D10A nickase | 2026-07-25 12:50:59 | 0 | |
|
pG1AK-sfGFP Resource Report Resource Website |
RRID:Addgene_71739 | sfGFP | Ampicillin and Kanamycin | PMID:27332993 | Plasmid from the Geobacillus plasmid set - a modular shuttle vector toolkit for thermophile metabolic engineering | Backbone Size:4719; Vector Backbone:pG1AK; Vector Types:Bacterial Expression, Synthetic Biology, Shuttle Vector; Bacterial Resistance:Ampicillin and Kanamycin | 2026-07-25 12:51:02 | 0 | ||
|
pG1AK Resource Report Resource Website |
RRID:Addgene_71736 | Ampicillin and Kanamycin | PMID:27332993 | Plasmid from the Geobacillus plasmid set - a modular shuttle vector toolkit for thermophile metabolic engineering | Backbone Size:4719; Vector Backbone:pG1AK; Vector Types:Bacterial Expression, Synthetic Biology, Shuttle Vector; Bacterial Resistance:Ampicillin and Kanamycin | 2026-07-25 12:51:02 | 0 | |||
|
pCRII-Sema4a-ISH-2kb Resource Report Resource Website |
RRID:Addgene_68029 | Semaphorin-4A | Mus musculus | Ampicillin and Kanamycin | PMID:21122816 | Backbone Marker:Invitrogen; Backbone Size:3973; Vector Backbone:pCRII-TOPO; Vector Types:mRNA In situ hybridization probe; Bacterial Resistance:Ampicillin and Kanamycin | a 2kb cDNA fragment for ISH probe synthesis | 2026-07-25 12:50:31 | 0 | |
|
pCRII-Sema4f-ISH-2kb Resource Report Resource Website |
RRID:Addgene_68033 | Semaphorin-4F | Mus musculus | Ampicillin and Kanamycin | PMID:21122816 | Backbone Marker:Invitrogen; Backbone Size:3973; Vector Backbone:pCRII-TOPO; Vector Types:mRNA In situ hybridization probe; Bacterial Resistance:Ampicillin and Kanamycin | 2026-07-25 12:50:31 | 0 | ||
|
pCRII-Sema4d-ISH-2kb Resource Report Resource Website |
RRID:Addgene_68032 | Semaphorin-4D | Mus musculus | Ampicillin and Kanamycin | PMID:21122816 | Backbone Marker:Invitrogen; Backbone Size:3973; Vector Backbone:pCRII-TOPO; Vector Types:mRNA In situ hybridization probe; Bacterial Resistance:Ampicillin and Kanamycin | 2026-07-25 12:50:31 | 0 | ||
|
pCRII-Sema4c-ISH-2kb Resource Report Resource Website |
RRID:Addgene_68031 | Semaphorin-4C | Mus musculus | Ampicillin and Kanamycin | PMID:21122816 | Backbone Marker:Invitrogen; Backbone Size:3973; Vector Backbone:pCRII-TOPO; Vector Types:mRNA In situ hybridization probe; Bacterial Resistance:Ampicillin and Kanamycin | 2026-07-25 12:50:31 | 0 | ||
|
pCRII-Sema4b-ISH-2kb Resource Report Resource Website |
RRID:Addgene_68030 | Semaphorin-4B | Mus musculus | Ampicillin and Kanamycin | PMID:21122816 | Backbone Marker:Invitrogen; Backbone Size:3973; Vector Backbone:pCRII-TOPO; Vector Types:mRNA In situ hybridization probe; Bacterial Resistance:Ampicillin and Kanamycin | 2026-07-25 12:50:31 | 0 | ||
|
pCRII-HSV2.3 TCR beta chain Resource Report Resource Website |
RRID:Addgene_74077 | TCR beta cDNA clone HSV2.3 | Mus musculus | Ampicillin and Kanamycin | PMID:11940116 | This plasmid contains the TCR beta chain cDNA from the HSV2.3 clone and was used to create the transgenic construct p3A9cbetaTCR.HSV2.3 (Addgene plasmid #69594). | Backbone Marker:Invitrogen ; Backbone Size:3947; Vector Backbone:pCRII; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin and Kanamycin | 2026-07-25 12:51:21 | 0 | |
|
pRGD-KmR Resource Report Resource Website |
RRID:Addgene_74108 | aphII | Synthetic | Ampicillin and Kanamycin | PMID:26921431 | Backbone Marker:Alexeyev, M.F., BioTechniques 18:52-54, 1995; Vector Backbone:pBSL15; Vector Types:Bacterial vector based on pMB1 replicon; Bacterial Resistance:Ampicillin and Kanamycin | 2026-07-25 12:51:21 | 0 | ||
|
pBS-TarHom-Tol2-kanaR-cryaa-CFP Resource Report Resource Website |
RRID:Addgene_74151 | Tol2-kanaR-cryaa-CFP | Synthetic | Ampicillin and Kanamycin | PMID:26818072 | Vector Backbone:pBluescript; Vector Types:; Bacterial Resistance:Ampicillin and Kanamycin | 2026-07-25 12:51:22 | 0 | ||
|
pJK640 Resource Report Resource Website |
RRID:Addgene_72467 | response regulator in two-component regulatory system with EvgS | Escherichia coli str. K-12 substr. MG1655 | Ampicillin and Kanamycin | TA cloning product with 286 bp 5'-UTR including EvgA binding site. | Backbone Size:3851; Vector Backbone:pDRIVE-1; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin and Kanamycin | 2026-07-25 12:51:08 | 0 | ||
|
pJK637 Resource Report Resource Website |
RRID:Addgene_72437 | DNA mismatch repair protein MutS (partial gene) | Acetobacter aceti 1023 | Ampicillin and Kanamycin | Used for nucleotide quantitation in RT-PCR and similar experiments for Acetobacter aceti 1023. Based on method described in M. Ishikawa, A. Okamoto-Kainuma, T. Jochi, I. Suzuki, K. Matsui, T Kaga, Y. Koizumi (2009) Cloning and characterization of grpE in Acetobacter pasteurianus NBRC 3283. J. Biosci. Bioeng. 109(1), 25–31[doi: 10.1016/j.jbiosc.2009.07.008] | Backbone Size:3851; Vector Backbone:pDRIVE-1; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin and Kanamycin | deletes nt 1-767 and nt 2086-2655 of mutS gene | 2026-07-25 12:51:08 | 0 |
Can't find your Plasmid?
We recommend that you click next to the search bar to check some helpful tips on searches and refine your search firstly. If you want to find a specific plasmid, it's easier to enter an RRID or an Addgene Catalog Number to search. You can refine the search results using Facets on the left side of the search results page. If you are on the table view, you can also search in a specific column by clicking the column title and enter the keywords.
If you still could not find your plasmid in the search results, please help us by registering it into the system — it's easy. Register it with Addgene.
Welcome to the NIF Resources search. From here you can search through a compilation of resources used by NIF and see how data is organized within our community.
You are currently on the Community Resources tab looking through categories and sources that NIF has compiled. You can navigate through those categories from here or change to a different tab to execute your search through. Each tab gives a different perspective on data.
If you have an account on NIF then you can log in from here to get additional features in NIF such as Collections, Saved Searches, and managing Resources.
Here is the search term that is being executed, you can type in anything you want to search for. Some tips to help searching:
If you are logged into NIF you can add data records to your collections to create custom spreadsheets across multiple sources of data.
Here are the facets that you can filter the data by.
If you have any further questions please check out our FAQs Page to ask questions and see our tutorials. Click this button to view this tutorial again.
Welcome to the Neuroscience Information Framework Project, designed to serve the biomedical research community. NIF maintains the largest searchable collection of neuroscience data, the largest catalog of biomedical resources, and the largest ontology for neuroscience on the web. We welcome all feedback and suggestions and are actively looking for resource providers to make their resources accessible through NIF. Learn about the tools available to help you share your data and discover a dynamic inventory of Web-based neuroscience resources.
