Searching the RRID Resource Information Network
Are you sure you want to leave this community? Leaving the community will revoke any permissions you have been granted in this community.
Species: Homo sapiens
Genetic Insert: hsa-miR-767-3p target
Vector Backbone Description: Vector Backbone:Low Sensor Backbone (LSB); Vector Types:Mammalian Expression, Synthetic Biology; Bacterial Resistance:Ampicillin and Kanamycin
References:
Comments: Please note that this plasmid is inherently unstable due to a repeating poly A element. We recommend performing a diagnostic digest on multiple colonies upon receipt. The depositors would like to note the presence of several discrepancies between the depositor sequence and physical plasmid sequence. In particular, the sequences upstream and downstream of the puromycin coding region have 10 bp insertions which do not affect the ability to perform puromycin selection. The sequences for those regions within the physical plasmids are as follows: Upstream of Puro: GAATTCGACCGCCTGTCTCAAGGTGCCACC; Downstream of Puro: GCTTTGAGACTACGCGTGAATTCACTCCTC. Please contact [email protected] if you are interested in this plasmid prior to placing an order.
Proper citation: RRID:Addgene_103733 Copy
Species: Homo sapiens
Genetic Insert: hsa-miR-766-5p target
Vector Backbone Description: Vector Backbone:Low Sensor Backbone (LSB); Vector Types:Mammalian Expression, Synthetic Biology; Bacterial Resistance:Ampicillin and Kanamycin
References:
Comments: Please note that this plasmid is inherently unstable due to a repeating poly A element. We recommend performing a diagnostic digest on multiple colonies upon receipt. The depositors would like to note the presence of several discrepancies between the depositor sequence and physical plasmid sequence. In particular, the sequences upstream and downstream of the puromycin coding region have 10 bp insertions which do not affect the ability to perform puromycin selection. The sequences for those regions within the physical plasmids are as follows: Upstream of Puro: GAATTCGACCGCCTGTCTCAAGGTGCCACC; Downstream of Puro: GCTTTGAGACTACGCGTGAATTCACTCCTC. Please contact [email protected] if you are interested in this plasmid prior to placing an order.
Proper citation: RRID:Addgene_103732 Copy
Species: Homo sapiens
Genetic Insert: hsa-miR-887-3p target
Vector Backbone Description: Vector Backbone:Low Sensor Backbone (LSB); Vector Types:Mammalian Expression, Synthetic Biology; Bacterial Resistance:Ampicillin and Kanamycin
References:
Comments: Please note that this plasmid is inherently unstable due to a repeating poly A element. We recommend performing a diagnostic digest on multiple colonies upon receipt. The depositors would like to note the presence of several discrepancies between the depositor sequence and physical plasmid sequence. In particular, the sequences upstream and downstream of the puromycin coding region have 10 bp insertions which do not affect the ability to perform puromycin selection. The sequences for those regions within the physical plasmids are as follows: Upstream of Puro: GAATTCGACCGCCTGTCTCAAGGTGCCACC; Downstream of Puro: GCTTTGAGACTACGCGTGAATTCACTCCTC. Please contact [email protected] if you are interested in this plasmid prior to placing an order.
Proper citation: RRID:Addgene_103746 Copy
Species: Homo sapiens
Genetic Insert: hsa-miR-885-3p target
Vector Backbone Description: Vector Backbone:Low Sensor Backbone (LSB); Vector Types:Mammalian Expression, Synthetic Biology; Bacterial Resistance:Ampicillin and Kanamycin
References:
Comments: Please note that this plasmid is inherently unstable due to a repeating poly A element. We recommend performing a diagnostic digest on multiple colonies upon receipt. The depositors would like to note the presence of several discrepancies between the depositor sequence and physical plasmid sequence. In particular, the sequences upstream and downstream of the puromycin coding region have 10 bp insertions which do not affect the ability to perform puromycin selection. The sequences for those regions within the physical plasmids are as follows: Upstream of Puro: GAATTCGACCGCCTGTCTCAAGGTGCCACC; Downstream of Puro: GCTTTGAGACTACGCGTGAATTCACTCCTC. Please contact [email protected] if you are interested in this plasmid prior to placing an order.
Proper citation: RRID:Addgene_103744 Copy
Species: Homo sapiens
Genetic Insert: hsa-miR-708-3p target
Vector Backbone Description: Vector Backbone:Low Sensor Backbone (LSB); Vector Types:Mammalian Expression, Synthetic Biology; Bacterial Resistance:Ampicillin and Kanamycin
References:
Comments: Please note that this plasmid is inherently unstable due to a repeating poly A element. We recommend performing a diagnostic digest on multiple colonies upon receipt. The depositors would like to note the presence of several discrepancies between the depositor sequence and physical plasmid sequence. In particular, the sequences upstream and downstream of the puromycin coding region have 10 bp insertions which do not affect the ability to perform puromycin selection. The sequences for those regions within the physical plasmids are as follows: Upstream of Puro: GAATTCGACCGCCTGTCTCAAGGTGCCACC; Downstream of Puro: GCTTTGAGACTACGCGTGAATTCACTCCTC. Please contact [email protected] if you are interested in this plasmid prior to placing an order.
Proper citation: RRID:Addgene_103724 Copy
Species: Homo sapiens
Genetic Insert: hsa-miR-7-5p target
Vector Backbone Description: Vector Backbone:Low Sensor Backbone (LSB); Vector Types:Mammalian Expression, Synthetic Biology; Bacterial Resistance:Ampicillin and Kanamycin
References:
Comments: Please note that this plasmid is inherently unstable due to a repeating poly A element. We recommend performing a diagnostic digest on multiple colonies upon receipt. The depositors would like to note the presence of several discrepancies between the depositor sequence and physical plasmid sequence. In particular, the sequences upstream and downstream of the puromycin coding region have 10 bp insertions which do not affect the ability to perform puromycin selection. The sequences for those regions within the physical plasmids are as follows: Upstream of Puro: GAATTCGACCGCCTGTCTCAAGGTGCCACC; Downstream of Puro: GCTTTGAGACTACGCGTGAATTCACTCCTC. Please contact [email protected] if you are interested in this plasmid prior to placing an order.
Proper citation: RRID:Addgene_103723 Copy
Species: Synthetic
Genetic Insert: Staphylococcus aureus guide RNA
Vector Backbone Description: Backbone Marker:Invitrogen; Backbone Size:3931; Vector Backbone:pCR2.1-TOPO; Vector Types:Mammalian Expression, CRISPR; Bacterial Resistance:Ampicillin and Kanamycin
References:
Comments:
Proper citation: RRID:Addgene_64710 Copy
Species: S. pyogenes
Genetic Insert: Cas9 nickase
Vector Backbone Description: Backbone Marker:Thermo-Fisher; Backbone Size:3900; Vector Backbone:PCR2-1 TOPO; Vector Types:in vitro transcription; Bacterial Resistance:Ampicillin and Kanamycin
References:
Comments: The poly A tail included in the sequence is sufficient for purification of full length transcript using an oligo dT column. This decreases the amount of incomplete transcripts (and therefore decreases truncated Cas9 proteins).
Proper citation: RRID:Addgene_71311 Copy
Species:
Genetic Insert: sfGFP
Vector Backbone Description: Backbone Size:4719; Vector Backbone:pG1AK; Vector Types:Bacterial Expression, Synthetic Biology, Shuttle Vector; Bacterial Resistance:Ampicillin and Kanamycin
References:
Comments: Plasmid from the Geobacillus plasmid set - a modular shuttle vector toolkit for thermophile metabolic engineering
Proper citation: RRID:Addgene_71739 Copy
Species:
Genetic Insert:
Vector Backbone Description: Backbone Size:4719; Vector Backbone:pG1AK; Vector Types:Bacterial Expression, Synthetic Biology, Shuttle Vector; Bacterial Resistance:Ampicillin and Kanamycin
References:
Comments: Plasmid from the Geobacillus plasmid set - a modular shuttle vector toolkit for thermophile metabolic engineering
Proper citation: RRID:Addgene_71736 Copy
Species: Mus musculus
Genetic Insert: Semaphorin-4A
Vector Backbone Description: Backbone Marker:Invitrogen; Backbone Size:3973; Vector Backbone:pCRII-TOPO; Vector Types:mRNA In situ hybridization probe; Bacterial Resistance:Ampicillin and Kanamycin
References:
Comments:
Proper citation: RRID:Addgene_68029 Copy
Species: Mus musculus
Genetic Insert: Semaphorin-4F
Vector Backbone Description: Backbone Marker:Invitrogen; Backbone Size:3973; Vector Backbone:pCRII-TOPO; Vector Types:mRNA In situ hybridization probe; Bacterial Resistance:Ampicillin and Kanamycin
References:
Comments:
Proper citation: RRID:Addgene_68033 Copy
Species: Mus musculus
Genetic Insert: Semaphorin-4D
Vector Backbone Description: Backbone Marker:Invitrogen; Backbone Size:3973; Vector Backbone:pCRII-TOPO; Vector Types:mRNA In situ hybridization probe; Bacterial Resistance:Ampicillin and Kanamycin
References:
Comments:
Proper citation: RRID:Addgene_68032 Copy
Species: Mus musculus
Genetic Insert: Semaphorin-4C
Vector Backbone Description: Backbone Marker:Invitrogen; Backbone Size:3973; Vector Backbone:pCRII-TOPO; Vector Types:mRNA In situ hybridization probe; Bacterial Resistance:Ampicillin and Kanamycin
References:
Comments:
Proper citation: RRID:Addgene_68031 Copy
Species: Mus musculus
Genetic Insert: Semaphorin-4B
Vector Backbone Description: Backbone Marker:Invitrogen; Backbone Size:3973; Vector Backbone:pCRII-TOPO; Vector Types:mRNA In situ hybridization probe; Bacterial Resistance:Ampicillin and Kanamycin
References:
Comments:
Proper citation: RRID:Addgene_68030 Copy
Species: Mus musculus
Genetic Insert: TCR beta cDNA clone HSV2.3
Vector Backbone Description: Backbone Marker:Invitrogen ; Backbone Size:3947; Vector Backbone:pCRII; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin and Kanamycin
References:
Comments: This plasmid contains the TCR beta chain cDNA from the HSV2.3 clone and was used to create the transgenic construct p3A9cbetaTCR.HSV2.3
(Addgene plasmid #69594).
Proper citation: RRID:Addgene_74077 Copy
Species: Synthetic
Genetic Insert: aphII
Vector Backbone Description: Backbone Marker:Alexeyev, M.F., BioTechniques 18:52-54, 1995; Vector Backbone:pBSL15; Vector Types:Bacterial vector based on pMB1 replicon; Bacterial Resistance:Ampicillin and Kanamycin
References:
Comments:
Proper citation: RRID:Addgene_74108 Copy
Species: Synthetic
Genetic Insert: Tol2-kanaR-cryaa-CFP
Vector Backbone Description: Vector Backbone:pBluescript; Vector Types:; Bacterial Resistance:Ampicillin and Kanamycin
References:
Comments:
Proper citation: RRID:Addgene_74151 Copy
Species: Escherichia coli str. K-12 substr. MG1655
Genetic Insert: response regulator in two-component regulatory system with EvgS
Vector Backbone Description: Backbone Size:3851; Vector Backbone:pDRIVE-1; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin and Kanamycin
References:
Comments: TA cloning product with 286 bp 5'-UTR including EvgA binding site.
Proper citation: RRID:Addgene_72467 Copy
Species: Acetobacter aceti 1023
Genetic Insert: DNA mismatch repair protein MutS (partial gene)
Vector Backbone Description: Backbone Size:3851; Vector Backbone:pDRIVE-1; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin and Kanamycin
References:
Comments: Used for nucleotide quantitation in RT-PCR and similar experiments for Acetobacter aceti 1023.
Based on method described in M. Ishikawa, A. Okamoto-Kainuma, T. Jochi, I. Suzuki, K. Matsui, T Kaga, Y. Koizumi (2009) Cloning and characterization of grpE in Acetobacter pasteurianus NBRC 3283. J. Biosci. Bioeng. 109(1), 25–31[doi: 10.1016/j.jbiosc.2009.07.008]
Proper citation: RRID:Addgene_72437 Copy
Can't find your Plasmid?
We recommend that you click next to the search bar to check some helpful tips on searches and refine your search firstly. If you want to find a specific plasmid, it's easier to enter an RRID or an Addgene Catalog Number to search. You can refine the search results using Facets on the left side of the search results page. If you are on the table view, you can also search in a specific column by clicking the column title and enter the keywords.
If you still could not find your plasmid in the search results, please help us by registering it into the system — it's easy. Register it with Addgene.
Welcome to the NIF Resources search. From here you can search through a compilation of resources used by NIF and see how data is organized within our community.
You are currently on the Community Resources tab looking through categories and sources that NIF has compiled. You can navigate through those categories from here or change to a different tab to execute your search through. Each tab gives a different perspective on data.
If you have an account on NIF then you can log in from here to get additional features in NIF such as Collections, Saved Searches, and managing Resources.
Here is the search term that is being executed, you can type in anything you want to search for. Some tips to help searching:
You can save any searches you perform for quick access to later from here.
We recognized your search term and included synonyms and inferred terms along side your term to help get the data you are looking for.
If you are logged into NIF you can add data records to your collections to create custom spreadsheets across multiple sources of data.
Here are the sources that were queried against in your search that you can investigate further.
Here are the categories present within NIF that you can filter your data on
Here are the subcategories present within this category that you can filter your data on
If you have any further questions please check out our FAQs Page to ask questions and see our tutorials. Click this button to view this tutorial again.
Welcome to the Neuroscience Information Framework Project, designed to serve the biomedical research community. NIF maintains the largest searchable collection of neuroscience data, the largest catalog of biomedical resources, and the largest ontology for neuroscience on the web. We welcome all feedback and suggestions and are actively looking for resource providers to make their resources accessible through NIF. Learn about the tools available to help you share your data and discover a dynamic inventory of Web-based neuroscience resources.
