Searching the RRID Resource Information Network
Are you sure you want to leave this community? Leaving the community will revoke any permissions you have been granted in this community.
Species: Homo sapiens
Genetic Insert: Syntaxin 17
Vector Backbone Description: Backbone Size:6400; Vector Backbone:CMV10 FLAG; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:23217709
Proper citation: RRID:Addgene_45911 Copy
Species: Rattus norvegicus
Genetic Insert: AT1R DRY-AAY
Vector Backbone Description: Backbone Marker:Invitrogen; Vector Backbone:pcDNA3.1; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:12746278
Comments: The cDNA of the rat vascular smooth muscle AT1A receptor was donated by Dr. K. E. Bernstein (Emory University, Atlanta, GA). Mutations in the rat AT1A receptor were performed with the Mutagene kit(Bio-Rad Laboratories, Inc., Hercules, CA)
N4D mutation is present to prevent glycosylation at this consensus site and steric hindrance of antibody binding.
Proper citation: RRID:Addgene_45759 Copy
Species: Mus musculus
Genetic Insert: vesicle-associated membrane protein 7
Vector Backbone Description: Backbone Size:6400; Vector Backbone:CMV10 FLAG; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:23217709
Proper citation: RRID:Addgene_45913 Copy
Species: Homo sapiens
Genetic Insert: syntaxin 18
Vector Backbone Description: Backbone Marker:Dr.Shoji Yamaoka of Tokyo Medical and Dental University; Backbone Size:6600; Vector Backbone:pMRXIP GFP-Ci2; Vector Types:Retroviral; Bacterial Resistance:Ampicillin
Defining Citation: PMID:23217709
Proper citation: RRID:Addgene_45918 Copy
Species: Mus musculus
Genetic Insert: GRP in situ probe
Vector Backbone Description: Backbone Marker:Invitrogen; Backbone Size:4000; Vector Backbone:pCRII-Topo; Vector Types:in situ; Bacterial Resistance:Ampicillin
Comments: For in vitro transcription, use the NotI restriction digest and Sp6 promoter for sense probe generation and the HindIII restriction digest and T7 promoter for antisense probe generation.
Proper citation: RRID:Addgene_45871 Copy
Species: Homo sapiens
Genetic Insert: Parkin
Vector Backbone Description: Backbone Size:4731; Vector Backbone:pEGFP-C2; Vector Types:Mammalian Expression; Bacterial Resistance:Kanamycin
Defining Citation: PMID:23661642
Proper citation: RRID:Addgene_45875 Copy
Species: Bos taurus
Genetic Insert: GRK2 S670D
Vector Backbone Description: Backbone Marker:Invitrogen; Backbone Size:5446; Vector Backbone:pcDNA3; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:10574913
Comments: The additional C619S mutation in the Addgene QC sequence does not affect plasmid function.
Proper citation: RRID:Addgene_45756 Copy
Species: Homo sapiens
Genetic Insert: Syntaxin 17
Vector Backbone Description: Backbone Marker:Dr.Shoji Yamaoka of Tokyo Medical and Dental University; Backbone Size:6600; Vector Backbone:pMRXIP GFP-Ci2; Vector Types:Retroviral; Bacterial Resistance:Ampicillin
Defining Citation: PMID:23217709
Proper citation: RRID:Addgene_45910 Copy
Species: Bos taurus
Genetic Insert: GRK2 S670A
Vector Backbone Description: Backbone Size:4754; Vector Backbone:pcDNA3; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:10574913
Comments: The additional V661G mutation in the Addgene QC sequence does not affect plasmid function.
Proper citation: RRID:Addgene_45755 Copy
Species: Homo sapiens
Genetic Insert: Parkin
Vector Backbone Description: Backbone Size:4731; Vector Backbone:pEGFP-C2; Vector Types:Mammalian Expression; Bacterial Resistance:Kanamycin
Defining Citation: PMID:23661642
Proper citation: RRID:Addgene_45876 Copy
Species: Mus musculus
Genetic Insert: Inhba in situ probe
Vector Backbone Description: Backbone Marker:Invitrogen; Backbone Size:4000; Vector Backbone:pCRII-Topo; Vector Types:in situ; Bacterial Resistance:Ampicillin
Defining Citation: PMID:19793993
Comments: The Inhba fragment was amplified by RT-PCR using the following primer pair:
GCGATCAGAAAGCTTCATGTG
AGACTGGCACCACTCTCCTG
For in vitro transcription, use the Spe1 restriction digest and T7 promoter for sense probe generation and the NotI restriction digest and Sp6 promoter for antisense probe generation.
Proper citation: RRID:Addgene_45868 Copy
Species: Mus musculus
Genetic Insert: eIF2S2 aa89-331
Vector Backbone Description: Backbone Marker:Clontech; Backbone Size:4700; Vector Backbone:pEGFP-N1; Vector Types:Mammalian Expression; Bacterial Resistance:Kanamycin
Defining Citation: PMID:11959995
Comments: PCR amplified using EcoRI/BamHI containing primers.
G321D mutation is also present.
Proper citation: RRID:Addgene_45901 Copy
Species: Mus musculus
Genetic Insert: eIF2S2
Vector Backbone Description: Backbone Marker:GE Healthcare; Backbone Size:4900; Vector Backbone:pGEX-2TK; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:11959995
Proper citation: RRID:Addgene_45900 Copy
Species: Mus musculus
Genetic Insert: TMTC4 in situ probe
Vector Backbone Description: Backbone Marker:Invitrogen; Backbone Size:4000; Vector Backbone:pCRII-Topo; Vector Types:in situ; Bacterial Resistance:Ampicillin
Defining Citation: PMID:19793993
Comments: The Tmtc4 fragment was amplified by RT-PCR using the following primer pair:
GAAGCAGAGCAGAGCTACCG
TCTGAACAGAGGCTTCATGC
For in vitro transcription, use the Spe1 restriction digest and T7 promoter for sense probe generation and the NotI restriction digest and Sp6 promoter for antisense probe generation.
Proper citation: RRID:Addgene_45869 Copy
Species: Homo sapiens
Genetic Insert: mitochondrial antiviral signaling protein
Vector Backbone Description: Backbone Marker:Sigma; Backbone Size:4700; Vector Backbone:pFLAG-CMV2; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:22427742
Proper citation: RRID:Addgene_45905 Copy
Species: Homo sapiens
Genetic Insert: mitochondrial antiviral signaling protein, mutation C508R
Vector Backbone Description: Backbone Marker:Sigma; Backbone Size:4700; Vector Backbone:pFLAG-CMV2; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:22427742
Proper citation: RRID:Addgene_45904 Copy
Species: Homo sapiens
Genetic Insert: ZAP(S) isoform
Vector Backbone Description: Backbone Marker:Invitrogen; Vector Backbone:pcDNA4; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:18225958
Comments: Contains a M202T and L388F amino acid change in the insert, not known to effect function.
Proper citation: RRID:Addgene_45906 Copy
Species: Homo sapiens
Genetic Insert: PECAM1
Vector Backbone Description: Backbone Marker:Clonetech; Backbone Size:6265; Vector Backbone:pLPCX; Vector Types:Mammalian Expression, Retroviral; Bacterial Resistance:Ampicillin
Defining Citation: PMID:23684974
Comments: Note: Compared to the current NCBI reference sequence for PECAM1, this plasmid has a V125L substitution. This is a known SNP. Also, two silent mutations were introduced to destroy two internal EcoRI sites.
Proper citation: RRID:Addgene_45851 Copy
Species: Mus musculus
Genetic Insert: Zfp536
Vector Backbone Description: Vector Backbone:Tet-O-FUW; Vector Types:Mammalian Expression, Lentiviral; Bacterial Resistance:Ampicillin
Defining Citation: PMID:23584610
Proper citation: RRID:Addgene_45845 Copy
Species: Mus musculus
Genetic Insert: VE-cadherin Tension Sensor
Vector Backbone Description: Backbone Marker:Clonetech; Backbone Size:6265; Vector Backbone:pLPCX; Vector Types:Mammalian Expression, Retroviral; Bacterial Resistance:Ampicillin
Defining Citation: PMID:23684974
Proper citation: RRID:Addgene_45848 Copy
Can't find your Plasmid?
We recommend that you click next to the search bar to check some helpful tips on searches and refine your search firstly. If you want to find a specific plasmid, it's easier to enter an RRID or an Addgene Catalog Number to search. You can refine the search results using Facets on the left side of the search results page. If you are on the table view, you can also search in a specific column by clicking the column title and enter the keywords.
If you still could not find your plasmid in the search results, please help us by registering it into the system — it's easy. Register it with Addgene.
Welcome to the NIF Resources search. From here you can search through a compilation of resources used by NIF and see how data is organized within our community.
You are currently on the Community Resources tab looking through categories and sources that NIF has compiled. You can navigate through those categories from here or change to a different tab to execute your search through. Each tab gives a different perspective on data.
If you have an account on NIF then you can log in from here to get additional features in NIF such as Collections, Saved Searches, and managing Resources.
Here is the search term that is being executed, you can type in anything you want to search for. Some tips to help searching:
You can save any searches you perform for quick access to later from here.
We recognized your search term and included synonyms and inferred terms along side your term to help get the data you are looking for.
If you are logged into NIF you can add data records to your collections to create custom spreadsheets across multiple sources of data.
Here are the sources that were queried against in your search that you can investigate further.
Here are the categories present within NIF that you can filter your data on
Here are the subcategories present within this category that you can filter your data on
If you have any further questions please check out our FAQs Page to ask questions and see our tutorials. Click this button to view this tutorial again.
Welcome to the Neuroscience Information Framework Project, designed to serve the biomedical research community. NIF maintains the largest searchable collection of neuroscience data, the largest catalog of biomedical resources, and the largest ontology for neuroscience on the web. We welcome all feedback and suggestions and are actively looking for resource providers to make their resources accessible through NIF. Learn about the tools available to help you share your data and discover a dynamic inventory of Web-based neuroscience resources.
