Searching the RRID Resource Information Network
Are you sure you want to leave this community? Leaving the community will revoke any permissions you have been granted in this community.
| Plasmid Name | Proper Citation | Insert Name | Organism | Bacterial Resistance | Defining Citation |
Comments |
|||||
|---|---|---|---|---|---|---|---|---|---|---|---|
|
pET23b-proMMP-7 Resource Report Resource Website |
RRID:Addgene_29524 | proMMP-7 | Homo sapiens | Ampicillin | PMID:19654318 | MMP7 sequence in the plasmid is suitable for expression in bacteria but NOT in mammalian cells, as the signal sequence is not included. The MMP7 amino acid sequence starts at amino acid 18 when compared to GenBank accession number NP_002414.1. Note that a superfluous methionine corresponding to the start signal for translation is present at the N-terminus of the expressed protein Please note that the His tag present in the vector is not in-frame with MMP-7 | Backbone Marker:EMD Biosciences; Backbone Size:3700; Vector Backbone:pET23b; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin | Addgene | 2026-11-07 01:13:34 | 0 | |
|
dsRed-cent2 Resource Report Resource Website 10+ mentions |
RRID:Addgene_29523 | Cent2 | Homo sapiens | Kanamycin | PMID:15173193 | Backbone Marker:Clontech; Backbone Size:4700; Vector Backbone:pDsRed1-N1; Vector Types:Mammalian Expression; Bacterial Resistance:Kanamycin | Addgene | 2026-11-07 01:13:34 | 10 | ||
|
Map3k1 Resource Report Resource Website |
RRID:Addgene_29581 | Map3k1 | Homo sapiens | Ampicillin | PMID:23790491 | Ligation-independent-cloning. | Backbone Size:5961; Vector Backbone:pMCSG10; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin | Constitutively Active. Contains catalytic domain D874-end. | Addgene | 2026-11-07 01:13:35 | 0 |
|
MKK4 Resource Report Resource Website 1+ mentions |
RRID:Addgene_29579 | MKK4 | Homo sapiens | Ampicillin | PMID:23790491 | Starting Met removed. Ligation-independent-cloning. | Backbone Size:5961; Vector Backbone:pMCSG10; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin | Addgene | 2026-11-07 01:13:35 | 2 | |
|
Jnk3a1 Resource Report Resource Website |
RRID:Addgene_29577 | Jnk3a1 | Homo sapiens | Ampicillin | PMID:23790491 | Ligation-independent-cloning. | Backbone Size:5286; Vector Backbone:pMCSG7; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin | Contains residues 40-402 | Addgene | 2026-11-07 01:13:35 | 0 |
|
MKK7 Resource Report Resource Website 1+ mentions |
RRID:Addgene_29576 | MKK7 | Mus musculus | Ampicillin | PMID:23790491 | Ligation-independent cloning. | Backbone Size:5961; Vector Backbone:pMCSG10; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin | Starting Met removed | Addgene | 2026-11-07 01:13:35 | 1 |
|
p38delta Resource Report Resource Website |
RRID:Addgene_29575 | p38delta | Mus musculus | Ampicillin | PMID:23790491 | Ligation-independent-cloning. | Backbone Size:5286; Vector Backbone:pMCSG7; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin | Starting Met replaced with Ala | Addgene | 2026-11-07 01:13:35 | 0 |
|
tol2-mpx-Dendra2 Resource Report Resource Website 1+ mentions |
RRID:Addgene_29574 | mpx-Dendra 2 | Dendronephthya | Ampicillin | PMID:21248150 | mpx is a promoter for neutrophil expression and was called zMPO in the associated publication | Backbone Size:3000; Vector Backbone:tol2; Vector Types:; Bacterial Resistance:Ampicillin | Addgene | 2026-11-07 01:13:35 | 2 | |
|
426Gal-FUS-YFP Resource Report Resource Website 1+ mentions |
RRID:Addgene_29592 | FUS | Homo sapiens | Ampicillin | PMID:21541367 | Backbone Marker:Susan Lindquist (Addgene plasmid # 14227); Backbone Size:8126; Vector Backbone:pAG426Gal-ccdB-EYFP; Vector Types:Yeast Expression; Bacterial Resistance:Ampicillin | Addgene | 2026-11-07 01:13:35 | 1 | ||
|
pBacPAK8-His-myc-Uba1 Resource Report Resource Website |
RRID:Addgene_29508 | Uba1 | Saccharomyces cerevisiae | Ampicillin | PMID:10973499 | Backbone Marker:Clontech; Backbone Size:5500; Vector Backbone:pBacPAK8; Vector Types:Insect Expression; Bacterial Resistance:Ampicillin | Addgene | 2026-11-07 01:13:34 | 0 | ||
|
pBacPAK8-myc-Rbx1 Resource Report Resource Website |
RRID:Addgene_29507 | Rbx1 | Mus musculus | Ampicillin | PMID:10973499 | Backbone Marker:Clontech; Backbone Size:5500; Vector Backbone:pBacPAK8; Vector Types:Insect Expression; Bacterial Resistance:Ampicillin | Addgene | 2026-11-07 01:13:34 | 0 | ||
|
pcDNA3/FLHIP1 Resource Report Resource Website 1+ mentions |
RRID:Addgene_29587 | Huntingtin-interacting protein 1 | Homo sapiens | Ampicillin | PMID:12163454 | Backbone Marker:Invitrogen; Backbone Size:5446; Vector Backbone:pcDNA3; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin | Addgene | 2026-11-07 01:13:35 | 1 | ||
|
pCDNA3.1(+) GFP-PIPKI{gamma}661-FLAG Resource Report Resource Website |
RRID:Addgene_29583 | phosphatidylinositol phosphate kinase type I gamma | Mus musculus | Ampicillin | PMID:17928408 | Please note that Addgene's sequencing results identified a single nucleotide mismatch at bp#440 when compared to the full sequence information provided by the depositing laboratory. | Backbone Marker:Invitrogen; Backbone Size:5424; Vector Backbone:pCDNA3.1(+); Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin | N/A | Addgene | 2026-11-07 01:13:35 | 0 |
|
Erk2 Resource Report Resource Website 1+ mentions |
RRID:Addgene_29582 | Erk2 | Rattus norvegicus | Ampicillin | PMID:23790491 | Ligation-independent-cloning. | Backbone Size:5286; Vector Backbone:pMCSG7; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin | Starting Met removed from Erk2 | Addgene | 2026-11-07 01:13:35 | 1 |
|
pCS2 GSK3-GFP Resource Report Resource Website 1+ mentions |
RRID:Addgene_29680 | glycogen synthase kinase 3 | Xenopus laevis | Ampicillin | PMID:21183076 | Backbone Size:4096; Vector Backbone:pCS2; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin | Addgene | 2026-11-07 01:13:36 | 1 | ||
|
pET His6 Gamma crystallin TEV LIC cloning vector (2X-T) Resource Report Resource Website |
RRID:Addgene_29714 | Ampicillin | This plasmid is an empty vector. Your gene can be inserted with a LIC cloning protocol. All 2-series vectors work as single-expression vectors, as well as transfer vectors for our polycistronic system. The LIC cloning site is flanked by 5 pairs of restriction sites, so that your gene can easily be subcloned into our polycistronic destination vectors (2D, 2E, or 2Z). 2X-T has a TEV-cleavable N-terminal His6-gamma crystallin fusion tag. Gamma crystallin can improve the expression and solubility of your target protein. To clone into this vector, add LIC v1 tags to the 5' end of your PCR primers. Forward - 5'TACTTCCAATCCAATGCA3' Reverse - 5'TTATCCACTTCCAATGTTATTA3' Linearize the plasmid with SspI and gel purify. When digesting the DNA with T4 polymerase, use dCTP for insert and dGTP for vector. More information on this vector can be found through http://qb3.berkeley.edu/qb3/macrolab/ | Backbone Size:5338; Vector Backbone:pET; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin | Addgene | 2026-11-07 01:13:37 | 0 | ||||
|
pET His6 ProteinG TEV LIC cloning vector (2P-T) Resource Report Resource Website 1+ mentions |
RRID:Addgene_29713 | Ampicillin | This plasmid is an empty vector. Your gene can be inserted with a LIC cloning protocol. All 2-series vectors work as single-expression vectors, as well as transfer vectors for our polycistronic system. The LIC cloning site is flanked by 5 pairs of restriction sites, so that your gene can easily be subcloned into our polycistronic destination vectors (2D, 2E, or 2Z). 2P-T has a TEV-cleavable N-terminal His6-Protein G fusion tag. Protein G can improve the expression and solubility of your target protein. To clone into this vector, add LIC v1 tags to the 5' end of your PCR primers. Forward - 5'TACTTCCAATCCAATGCA3' Reverse - 5'TTATCCACTTCCAATGTTATTA3' Linearize the plasmid with SspI and gel purify. When digesting the DNA with T4 polymerase, use dCTP for insert and dGTP for vector. More information on this vector can be found through http://qb3.berkeley.edu/qb3/macrolab/ | Backbone Size:4975; Vector Backbone:pET; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin | Addgene | 2026-11-07 01:13:37 | 2 | ||||
|
pET His6 Thioredoxin TEV LIC cloning vector (2T-T) Resource Report Resource Website 1+ mentions |
RRID:Addgene_29712 | Ampicillin | This plasmid is an empty vector. Your gene can be inserted with a LIC cloning protocol. All 2-series vectors work as single-expression vectors, as well as transfer vectors for our polycistronic system. The LIC cloning site is flanked by 5 pairs of restriction sites, so that your gene can easily be subcloned into our polycistronic destination vectors (2D, 2E, or 2Z). 2T-T has a TEV-cleavable N-terminal His6-thioredoxin fusion tag. Thioredoxin can improve the solubility of your target protein by promoting correct disulfide bond formation. To clone into this vector, add LIC v1 tags to the 5' end of your PCR primers. Forward - 5'TACTTCCAATCCAATGCA3' Reverse - 5'TTATCCACTTCCAATGTTATTA3' Linearize the plasmid with SspI and gel purify. When digesting the DNA with T4 polymerase, use dCTP for insert and dGTP for vector. More information on this vector can be found through http://qb3.berkeley.edu/qb3/macrolab/ | Backbone Size:5131; Vector Backbone:pET; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin | Addgene | 2026-11-07 01:13:37 | 1 | ||||
|
pET His6 Mocr TEV LIC cloning vector (2O-T) Resource Report Resource Website 1+ mentions |
RRID:Addgene_29710 | Ampicillin | This plasmid is an empty vector. Your gene can be inserted with a LIC cloning protocol. All 2-series vectors work as single-expression vectors, as well as transfer vectors for our polycistronic system. The LIC cloning site is flanked by 5 pairs of restriction sites, so that your gene can easily be subcloned into our polycistronic destination vectors (2D, 2E, or 2Z). 2O-T has a TEV-cleavable N-terminal His6-Mocr fusion tag. Mocr can improve the expression and solubility of your target protein. To clone into this vector, add LIC v1 tags to the 5' end of your PCR primers. Forward - 5'TACTTCCAATCCAATGCA3' Reverse - 5'TTATCCACTTCCAATGTTATTA3' Linearize the plasmid with SspI and gel purify. When digesting the DNA with T4 polymerase, use dCTP for insert and dGTP for vector. More information on this vector can be found through http://qb3.berkeley.edu/qb3/macrolab/ | Backbone Size:5908; Vector Backbone:pET; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin | Addgene | 2026-11-07 01:13:37 | 6 | ||||
|
mCherry-Pak3(60-113)/S74A/F84A-mCherry-C1 Resource Report Resource Website 1+ mentions |
RRID:Addgene_29676 | Pak3 | Homo sapiens | Kanamycin | PMID:21423166 | Backbone Size:4645; Vector Backbone:mCherry-C1; Vector Types:Mammalian Expression; Bacterial Resistance:Kanamycin | aa60-113 only; S74A F84A | Addgene | 2026-11-07 01:13:36 | 3 |
Can't find your Plasmid?
We recommend that you click next to the search bar to check some helpful tips on searches and refine your search firstly. If you want to find a specific plasmid, it's easier to enter an RRID or an Addgene Catalog Number to search. You can refine the search results using Facets on the left side of the search results page. If you are on the table view, you can also search in a specific column by clicking the column title and enter the keywords.
If you still could not find your plasmid in the search results, please help us by registering it into the system — it's easy. Register it with Addgene.
Welcome to the NIF Resources search. From here you can search through a compilation of resources used by NIF and see how data is organized within our community.
You are currently on the Community Resources tab looking through categories and sources that NIF has compiled. You can navigate through those categories from here or change to a different tab to execute your search through. Each tab gives a different perspective on data.
If you have an account on NIF then you can log in from here to get additional features in NIF such as Collections, Saved Searches, and managing Resources.
Here is the search term that is being executed, you can type in anything you want to search for. Some tips to help searching:
If you are logged into NIF you can add data records to your collections to create custom spreadsheets across multiple sources of data.
Here are the facets that you can filter the data by.
If you have any further questions please check out our FAQs Page to ask questions and see our tutorials. Click this button to view this tutorial again.
Welcome to the Neuroscience Information Framework Project, designed to serve the biomedical research community. NIF maintains the largest searchable collection of neuroscience data, the largest catalog of biomedical resources, and the largest ontology for neuroscience on the web. We welcome all feedback and suggestions and are actively looking for resource providers to make their resources accessible through NIF. Learn about the tools available to help you share your data and discover a dynamic inventory of Web-based neuroscience resources.
