Searching the RRID Resource Information Network
Are you sure you want to leave this community? Leaving the community will revoke any permissions you have been granted in this community.
| Plasmid Name | Proper Citation | Insert Name | Organism | Bacterial Resistance | Defining Citation |
Comments |
|||||
|---|---|---|---|---|---|---|---|---|---|---|---|
|
pML374_CLTA-N-term_XTEN80-mEGFP-3xHA_pTMPLT Resource Report Resource Website |
RRID:Addgene_227893 | CLTA homology arms with mEGFP-3xHA for insertion at N terminus | Homo sapiens | Ampicillin | PMID:39742809 | Backbone Marker:Twist Biosciences; Vector Backbone:pTwist Amp High Copy; Vector Types:CRISPR; Bacterial Resistance:Ampicillin | Addgene | 2026-10-10 02:09:06 | 0 | ||
|
pML307_SEC61B-N-term_XTEN80-mEGFP-3xHA_pTMPLT Resource Report Resource Website |
RRID:Addgene_227894 | SEC61B homology arms with mEGFP-3xHA for insertion at N terminus | Homo sapiens | Ampicillin | PMID:39742809 | Backbone Marker:Twist Biosciences; Vector Backbone:pTwist Amp High Copy; Vector Types:CRISPR; Bacterial Resistance:Ampicillin | Addgene | 2026-10-10 02:09:06 | 0 | ||
|
pLViN-E-cadherin-GFP Resource Report Resource Website |
RRID:Addgene_229710 | CDH1 E-CADHERIN Human | Homo sapiens | Ampicillin | PMID:37480844 | Backbone Size:8357; Vector Backbone:PLViP; Vector Types:Mammalian Expression, Lentiviral; Bacterial Resistance:Ampicillin | Addgene | 2026-10-10 02:09:07 | 0 | ||
|
pML384_NCLN-C-term_XTEN80-mEGFP-3xHA_pTMPLT Resource Report Resource Website |
RRID:Addgene_227897 | NCLN homology arms with mEGFP-3xHA for insertion at C terminus | Homo sapiens | Ampicillin | PMID:39742809 | Backbone Marker:Twist Biosciences; Vector Backbone:pTwist Amp High Copy; Vector Types:CRISPR; Bacterial Resistance:Ampicillin | Addgene | 2026-10-10 02:09:06 | 0 | ||
|
pML365_HSP90AA1-N-term_XTEN80-mEGFP-3xHA_pTMPLT Resource Report Resource Website |
RRID:Addgene_227921 | HSP90AA homology arms with XTEN80-mEGFP-3xHA for insertion at N terminus | Homo sapiens | Ampicillin | PMID:39742809 | Backbone Marker:Twist Biosciences; Vector Backbone:pTwist Amp High Copy; Vector Types:CRISPR; Bacterial Resistance:Ampicillin | Addgene | 2026-10-10 02:09:07 | 0 | ||
|
pETcon-pGAL1-Aga2-α-Synuclein-c_myc Resource Report Resource Website |
RRID:Addgene_225222 | α-Synuclein | Homo sapiens | Ampicillin | PMID:37638647 | Backbone Size:5740; Vector Backbone:pETcon(-); Vector Types:Yeast Expression; Bacterial Resistance:Ampicillin | Addgene | 2026-10-10 02:09:06 | 0 | ||
|
pRS316-SSD1-L1374 Resource Report Resource Website |
RRID:Addgene_226278 | SSD1 | Saccharomyces cerevisiae | Ampicillin | PMID:40037589 | Please visit https://doi.org/10.1101/2024.08.28.610086 for bioRxiv preprint. | Backbone Marker:Sikorski and Hieter, 1989, Genetics; Backbone Size:4887; Vector Backbone:pRS316; Vector Types:Yeast Expression; Bacterial Resistance:Ampicillin | Addgene | 2026-10-10 02:09:06 | 0 | |
|
pML364_PSMB7-C-term_XTEN80-mEGFP-3xHA_pTMPLT Resource Report Resource Website |
RRID:Addgene_227922 | PSMB7 homology arms with XTEN80-mEGFP-3xHA for insertion at C terminus | Homo sapiens | Ampicillin | PMID:39742809 | Backbone Marker:Twist Biosciences; Vector Backbone:pTwist Amp High Copy; Vector Types:CRISPR; Bacterial Resistance:Ampicillin | Addgene | 2026-10-10 02:09:07 | 0 | ||
|
pML484_RPL36-C-term_XTEN80-mEGFP-3xHA_pTMPLT Resource Report Resource Website |
RRID:Addgene_227923 | RPL36 homology arms with XTEN80-mEGFP-3xHA for insertion at C terminus | Homo sapiens | Ampicillin | PMID:39742809 | Backbone Marker:Twist Biosciences; Vector Backbone:pTwist Amp High Copy; Vector Types:CRISPR; Bacterial Resistance:Ampicillin | Addgene | 2026-10-10 02:09:07 | 0 | ||
|
pML390_YWHAQ-C-term_XTEN80-mEGFP-3xHA_pTMPLT Resource Report Resource Website |
RRID:Addgene_227925 | YWHAQ homology arms with XTEN80-mEGFP-3xHA for insertion at C terminus | Homo sapiens | Ampicillin | PMID:39742809 | Backbone Marker:Twist Biosciences; Vector Backbone:pTwist Amp High Copy; Vector Types:CRISPR; Bacterial Resistance:Ampicillin | Addgene | 2026-10-10 02:09:07 | 0 | ||
|
pETcon-pGAL1-Aga2-Htt(46Q)-c_myc Resource Report Resource Website |
RRID:Addgene_225229 | Aga2 | Saccharomyces cerevisiae | Ampicillin | PMID:38116434 | Backbone Size:5740; Vector Backbone:pETcon(-); Vector Types:Yeast Expression; Bacterial Resistance:Ampicillin | Addgene | 2026-10-10 02:09:06 | 0 | ||
|
FLAG-MARK2-CR Resource Report Resource Website |
RRID:Addgene_229421 | MARK2-CR | Homo sapiens | Ampicillin | PMID:39058094 | Vector Backbone:LentiVi; Vector Types:Mammalian Expression, Lentiviral; Bacterial Resistance:Ampicillin | silent mutation CRISPR resistant | Addgene | 2026-10-10 02:09:07 | 0 | |
|
pETcon-pGAL1-Aga2-Htt(25Q)-c_myc Resource Report Resource Website |
RRID:Addgene_225228 | Aga2 | Saccharomyces cerevisiae | Ampicillin | PMID:38116434 | Backbone Size:5740; Vector Backbone:pETcon(-); Vector Types:Yeast Expression; Bacterial Resistance:Ampicillin | Addgene | 2026-10-10 02:09:06 | 0 | ||
|
pUC_cohNaV1.1_2009aa_IRES2_GFP Resource Report Resource Website |
RRID:Addgene_227642 | NaV1.1 | Homo sapiens | Ampicillin | Backbone Marker:Azenta; Vector Backbone:pUC-GW-Amp; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin | Addgene | 2026-10-10 02:09:06 | 0 | |||
|
pcDNA3puro-mGFP-FMR1iso1-G266E Resource Report Resource Website |
RRID:Addgene_225468 | FMR1 isoform 1 | Homo sapiens | Ampicillin | PMID:37961296 | Resistant to shRNA TRCN0000059759 (target sequence GCGTTTGGAGAGATTACAAAT). Please visit https://doi.org/10.1101/2023.11.05.565677 for bioRxiv preprint. | Backbone Marker:Mayr Lab; Vector Backbone:pcDNA3-puro; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin | G266E | Addgene | 2026-10-10 02:09:06 | 0 |
|
pAAV-MYL2-HA-TadA8e-Sauri N aa1-438-inteinN-U6-Camk2d sgRNA7 Resource Report Resource Website |
RRID:Addgene_226678 | MYL2, TadA, nSauri Cas9N, inteinN | Ampicillin | PMID:39817340 | Vector Backbone:pAAV-CMV-TadA8e-SpG N aa2-713-InteinN; Vector Types:AAV; Bacterial Resistance:Ampicillin | Addgene | 2026-10-10 02:09:06 | 0 | |||
|
pcDNA3.1(-)-EGFP-AP4-cyto Resource Report Resource Website |
RRID:Addgene_229694 | EGFP; Control construct with tandem AP4 motifs (cytoplasm) | Listeria monocytogenes | Ampicillin | PMID:16371509 | Backbone Size:5401; Vector Backbone:pcDNA 3.1(-) ; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin | Addgene | 2026-10-10 02:09:07 | 0 | ||
|
pLViP-LifeAct-iRFP670 Resource Report Resource Website |
RRID:Addgene_229699 | Synthetic construct LifeAct-mTurquoise gene | Synthetic | Ampicillin | PMID:37480844 | Backbone Size:8195; Vector Backbone:PLViP; Vector Types:Mammalian Expression, Lentiviral; Bacterial Resistance:Ampicillin | Addgene | 2026-10-10 02:09:07 | 0 | ||
|
pGH897 Resource Report Resource Website |
RRID:Addgene_230841 | nDivA-BE | Ampicillin | PMID:40613705 | Please visit https://doi.org/10.1101/2024.11.18.621003 for the bioRxiv preprint. | Vector Backbone:pGH483; Vector Types:Mammalian Expression, Lentiviral; Bacterial Resistance:Ampicillin | Addgene | 2026-10-10 02:09:07 | 0 | ||
|
AP2u2-CMV-S_protein Resource Report Resource Website |
RRID:Addgene_226456 | Spike Protein | SARS-CoV2 | Ampicillin | PMID:38633598 | Backbone Size:5216; Vector Backbone:AP2u2-mCherry; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin | Addgene | 2026-10-10 02:09:06 | 0 |
Can't find your Plasmid?
We recommend that you click next to the search bar to check some helpful tips on searches and refine your search firstly. If you want to find a specific plasmid, it's easier to enter an RRID or an Addgene Catalog Number to search. You can refine the search results using Facets on the left side of the search results page. If you are on the table view, you can also search in a specific column by clicking the column title and enter the keywords.
If you still could not find your plasmid in the search results, please help us by registering it into the system — it's easy. Register it with Addgene.
Welcome to the NIF Resources search. From here you can search through a compilation of resources used by NIF and see how data is organized within our community.
You are currently on the Community Resources tab looking through categories and sources that NIF has compiled. You can navigate through those categories from here or change to a different tab to execute your search through. Each tab gives a different perspective on data.
If you have an account on NIF then you can log in from here to get additional features in NIF such as Collections, Saved Searches, and managing Resources.
Here is the search term that is being executed, you can type in anything you want to search for. Some tips to help searching:
If you are logged into NIF you can add data records to your collections to create custom spreadsheets across multiple sources of data.
Here are the facets that you can filter the data by.
If you have any further questions please check out our FAQs Page to ask questions and see our tutorials. Click this button to view this tutorial again.
Welcome to the Neuroscience Information Framework Project, designed to serve the biomedical research community. NIF maintains the largest searchable collection of neuroscience data, the largest catalog of biomedical resources, and the largest ontology for neuroscience on the web. We welcome all feedback and suggestions and are actively looking for resource providers to make their resources accessible through NIF. Learn about the tools available to help you share your data and discover a dynamic inventory of Web-based neuroscience resources.
