Searching the RRID Resource Information Network
Are you sure you want to leave this community? Leaving the community will revoke any permissions you have been granted in this community.
Species: Homo sapiens
Genetic Insert: proMMP-7
Vector Backbone Description: Backbone Marker:EMD Biosciences; Backbone Size:3700; Vector Backbone:pET23b; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:19654318
Comments: MMP7 sequence in the plasmid is suitable for expression in bacteria but NOT in mammalian cells, as the signal sequence is not included.
The MMP7 amino acid sequence starts at amino acid 18 when compared to GenBank accession number NP_002414.1. Note that a superfluous methionine corresponding to the start signal for translation is present at the N-terminus of the expressed protein
Please note that the His tag present in the vector is not in-frame with MMP-7
Proper citation: RRID:Addgene_29524 Copy
Species: Homo sapiens
Genetic Insert: Cent2
Vector Backbone Description: Backbone Marker:Clontech; Backbone Size:4700; Vector Backbone:pDsRed1-N1; Vector Types:Mammalian Expression; Bacterial Resistance:Kanamycin
Defining Citation: PMID:15173193
Proper citation: RRID:Addgene_29523 Copy
Species: Homo sapiens
Genetic Insert: Map3k1
Vector Backbone Description: Backbone Size:5961; Vector Backbone:pMCSG10; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:23790491
Comments: Ligation-independent-cloning.
Proper citation: RRID:Addgene_29581 Copy
Species: Homo sapiens
Genetic Insert: MKK4
Vector Backbone Description: Backbone Size:5961; Vector Backbone:pMCSG10; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:23790491
Comments: Starting Met removed.
Ligation-independent-cloning.
Proper citation: RRID:Addgene_29579 Copy
Species: Homo sapiens
Genetic Insert: Jnk3a1
Vector Backbone Description: Backbone Size:5286; Vector Backbone:pMCSG7; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:23790491
Comments: Ligation-independent-cloning.
Proper citation: RRID:Addgene_29577 Copy
Species: Mus musculus
Genetic Insert: MKK7
Vector Backbone Description: Backbone Size:5961; Vector Backbone:pMCSG10; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:23790491
Comments: Ligation-independent cloning.
Proper citation: RRID:Addgene_29576 Copy
Species: Mus musculus
Genetic Insert: p38delta
Vector Backbone Description: Backbone Size:5286; Vector Backbone:pMCSG7; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:23790491
Comments: Ligation-independent-cloning.
Proper citation: RRID:Addgene_29575 Copy
Species: Dendronephthya
Genetic Insert: mpx-Dendra 2
Vector Backbone Description: Backbone Size:3000; Vector Backbone:tol2; Vector Types:; Bacterial Resistance:Ampicillin
Defining Citation: PMID:21248150
Comments: mpx is a promoter for neutrophil expression and was called zMPO in the associated publication
Proper citation: RRID:Addgene_29574 Copy
Species: Homo sapiens
Genetic Insert: FUS
Vector Backbone Description: Backbone Marker:Susan Lindquist (Addgene plasmid # 14227); Backbone Size:8126; Vector Backbone:pAG426Gal-ccdB-EYFP; Vector Types:Yeast Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:21541367
Proper citation: RRID:Addgene_29592 Copy
Species: Saccharomyces cerevisiae
Genetic Insert: Uba1
Vector Backbone Description: Backbone Marker:Clontech; Backbone Size:5500; Vector Backbone:pBacPAK8; Vector Types:Insect Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:10973499
Proper citation: RRID:Addgene_29508 Copy
Species: Mus musculus
Genetic Insert: Rbx1
Vector Backbone Description: Backbone Marker:Clontech; Backbone Size:5500; Vector Backbone:pBacPAK8; Vector Types:Insect Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:10973499
Proper citation: RRID:Addgene_29507 Copy
Species: Homo sapiens
Genetic Insert: Huntingtin-interacting protein 1
Vector Backbone Description: Backbone Marker:Invitrogen; Backbone Size:5446; Vector Backbone:pcDNA3; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:12163454
Proper citation: RRID:Addgene_29587 Copy
Species: Mus musculus
Genetic Insert: phosphatidylinositol phosphate kinase type I gamma
Vector Backbone Description: Backbone Marker:Invitrogen; Backbone Size:5424; Vector Backbone:pCDNA3.1(+); Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:17928408
Comments: Please note that Addgene's sequencing results identified a single nucleotide mismatch at bp#440 when compared to the full sequence information provided by the depositing laboratory.
Proper citation: RRID:Addgene_29583 Copy
Species: Rattus norvegicus
Genetic Insert: Erk2
Vector Backbone Description: Backbone Size:5286; Vector Backbone:pMCSG7; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:23790491
Comments: Ligation-independent-cloning.
Proper citation: RRID:Addgene_29582 Copy
Species: Xenopus laevis
Genetic Insert: glycogen synthase kinase 3
Vector Backbone Description: Backbone Size:4096; Vector Backbone:pCS2; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:21183076
Proper citation: RRID:Addgene_29680 Copy
Vector Backbone Description: Backbone Size:5338; Vector Backbone:pET; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin
Comments: This plasmid is an empty vector. Your gene can be inserted with a LIC cloning protocol. All 2-series vectors work as single-expression vectors, as well as transfer vectors for our polycistronic system.
The LIC cloning site is flanked by 5 pairs of restriction sites, so that your gene can easily be subcloned into our polycistronic destination vectors (2D, 2E, or 2Z).
2X-T has a TEV-cleavable N-terminal His6-gamma crystallin fusion tag. Gamma crystallin can improve the expression and solubility of your target protein.
To clone into this vector, add LIC v1 tags to the 5' end of your PCR primers.
Forward - 5'TACTTCCAATCCAATGCA3'
Reverse - 5'TTATCCACTTCCAATGTTATTA3'
Linearize the plasmid with SspI and gel purify.
When digesting the DNA with T4 polymerase, use dCTP for insert and dGTP for vector.
More information on this vector can be found through http://qb3.berkeley.edu/qb3/macrolab/
Proper citation: RRID:Addgene_29714 Copy
Vector Backbone Description: Backbone Size:4975; Vector Backbone:pET; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin
Comments: This plasmid is an empty vector. Your gene can be inserted with a LIC cloning protocol. All 2-series vectors work as single-expression vectors, as well as transfer vectors for our polycistronic system.
The LIC cloning site is flanked by 5 pairs of restriction sites, so that your gene can easily be subcloned into our polycistronic destination vectors (2D, 2E, or 2Z).
2P-T has a TEV-cleavable N-terminal His6-Protein G fusion tag. Protein G can improve the expression and solubility of your target protein.
To clone into this vector, add LIC v1 tags to the 5' end of your PCR primers.
Forward - 5'TACTTCCAATCCAATGCA3'
Reverse - 5'TTATCCACTTCCAATGTTATTA3'
Linearize the plasmid with SspI and gel purify.
When digesting the DNA with T4 polymerase, use dCTP for insert and dGTP for vector.
More information on this vector can be found through http://qb3.berkeley.edu/qb3/macrolab/
Proper citation: RRID:Addgene_29713 Copy
Vector Backbone Description: Backbone Size:5131; Vector Backbone:pET; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin
Comments: This plasmid is an empty vector. Your gene can be inserted with a LIC cloning protocol. All 2-series vectors work as single-expression vectors, as well as transfer vectors for our polycistronic system.
The LIC cloning site is flanked by 5 pairs of restriction sites, so that your gene can easily be subcloned into our polycistronic destination vectors (2D, 2E, or 2Z).
2T-T has a TEV-cleavable N-terminal His6-thioredoxin fusion tag. Thioredoxin can improve the solubility of your target protein by promoting correct disulfide bond formation.
To clone into this vector, add LIC v1 tags to the 5' end of your PCR primers.
Forward - 5'TACTTCCAATCCAATGCA3'
Reverse - 5'TTATCCACTTCCAATGTTATTA3'
Linearize the plasmid with SspI and gel purify.
When digesting the DNA with T4 polymerase, use dCTP for insert and dGTP for vector.
More information on this vector can be found through http://qb3.berkeley.edu/qb3/macrolab/
Proper citation: RRID:Addgene_29712 Copy
Vector Backbone Description: Backbone Size:5908; Vector Backbone:pET; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin
Comments: This plasmid is an empty vector. Your gene can be inserted with a LIC cloning protocol. All 2-series vectors work as single-expression vectors, as well as transfer vectors for our polycistronic system.
The LIC cloning site is flanked by 5 pairs of restriction sites, so that your gene can easily be subcloned into our polycistronic destination vectors (2D, 2E, or 2Z).
2O-T has a TEV-cleavable N-terminal His6-Mocr fusion tag. Mocr can improve the expression and solubility of your target protein.
To clone into this vector, add LIC v1 tags to the 5' end of your PCR primers.
Forward - 5'TACTTCCAATCCAATGCA3'
Reverse - 5'TTATCCACTTCCAATGTTATTA3'
Linearize the plasmid with SspI and gel purify.
When digesting the DNA with T4 polymerase, use dCTP for insert and dGTP for vector.
More information on this vector can be found through http://qb3.berkeley.edu/qb3/macrolab/
Proper citation: RRID:Addgene_29710 Copy
Species: Homo sapiens
Genetic Insert: Pak3
Vector Backbone Description: Backbone Size:4645; Vector Backbone:mCherry-C1; Vector Types:Mammalian Expression; Bacterial Resistance:Kanamycin
Defining Citation: PMID:21423166
Proper citation: RRID:Addgene_29676 Copy
Can't find your Plasmid?
We recommend that you click next to the search bar to check some helpful tips on searches and refine your search firstly. If you want to find a specific plasmid, it's easier to enter an RRID or an Addgene Catalog Number to search. You can refine the search results using Facets on the left side of the search results page. If you are on the table view, you can also search in a specific column by clicking the column title and enter the keywords.
If you still could not find your plasmid in the search results, please help us by registering it into the system — it's easy. Register it with Addgene.
Welcome to the NIF Resources search. From here you can search through a compilation of resources used by NIF and see how data is organized within our community.
You are currently on the Community Resources tab looking through categories and sources that NIF has compiled. You can navigate through those categories from here or change to a different tab to execute your search through. Each tab gives a different perspective on data.
If you have an account on NIF then you can log in from here to get additional features in NIF such as Collections, Saved Searches, and managing Resources.
Here is the search term that is being executed, you can type in anything you want to search for. Some tips to help searching:
You can save any searches you perform for quick access to later from here.
We recognized your search term and included synonyms and inferred terms along side your term to help get the data you are looking for.
If you are logged into NIF you can add data records to your collections to create custom spreadsheets across multiple sources of data.
Here are the sources that were queried against in your search that you can investigate further.
Here are the categories present within NIF that you can filter your data on
Here are the subcategories present within this category that you can filter your data on
If you have any further questions please check out our FAQs Page to ask questions and see our tutorials. Click this button to view this tutorial again.
Welcome to the Neuroscience Information Framework Project, designed to serve the biomedical research community. NIF maintains the largest searchable collection of neuroscience data, the largest catalog of biomedical resources, and the largest ontology for neuroscience on the web. We welcome all feedback and suggestions and are actively looking for resource providers to make their resources accessible through NIF. Learn about the tools available to help you share your data and discover a dynamic inventory of Web-based neuroscience resources.
