Searching the RRID Resource Information Network
Are you sure you want to leave this community? Leaving the community will revoke any permissions you have been granted in this community.
Species: Other
Genetic Insert: CRISPR array
Vector Backbone Description: Backbone Marker:PMID:26013814; Vector Backbone:pCDF-casBCDE; Vector Types:Bacterial Expression; Bacterial Resistance:Streptomycin
References:
Comments:
Proper citation: RRID:Addgene_89732 Copy
Species: Other
Genetic Insert: CRISPR array
Vector Backbone Description: Backbone Marker:PMID:26013814; Vector Backbone:pCDF-casBCDE; Vector Types:Bacterial Expression; Bacterial Resistance:Streptomycin
References:
Comments:
Proper citation: RRID:Addgene_89731 Copy
Species: Other
Genetic Insert: CRISPR array
Vector Backbone Description: Backbone Marker:PMID:26013814; Vector Backbone:pCDF-casBCDE; Vector Types:Bacterial Expression; Bacterial Resistance:Streptomycin
References:
Comments:
Proper citation: RRID:Addgene_89727 Copy
Species: Other
Genetic Insert: CRISPR array
Vector Backbone Description: Backbone Marker:PMID:26013814; Vector Backbone:pCDF-casBCDE; Vector Types:Bacterial Expression; Bacterial Resistance:Streptomycin
References:
Comments:
Proper citation: RRID:Addgene_89729 Copy
Species:
Genetic Insert: Genotype: MC4100 ∆clpPX
Vector Backbone Description: Vector Backbone:none; Vector Types:; Bacterial Resistance:Streptomycin
References:
Comments: Strain DHL708 was built by deleting the clpPX operon with lambda-Red mediated homologous recombination. The FRT-flanked Kan cassette was then flipped out using the FLP recombinase (pCP20).
The deletion region can be PCR-amplified and sequenced using the primers CCGCTCGAGTTTACGCAGCATAACGCGCTAAATTC and CGTCAGTATATGGGGATGTTTCCCC.
Originally described in Landgraf, D., Okumus, B., Chien, P., Baker, T. A. & Paulsson, J. Segregation of molecules at cell division reveals native protein localization. Nat Methods 9, 480–482 (2012).
Proper citation: RRID:Addgene_98417 Copy
Species: Parageobacillus thermoglucosidasius
Genetic Insert: adhT
Vector Backbone Description: Vector Backbone:pZASS; Vector Types:Bacterial Expression; Bacterial Resistance:Streptomycin
References:
Comments: Please visit https://doi.org/10.1101/2024.10.31.621308 for bioRxiv preprint.
Proper citation: RRID:Addgene_231854 Copy
Species:
Genetic Insert:
Vector Backbone Description: Vector Backbone:genome; Vector Types:; Bacterial Resistance:Streptomycin
References:
Comments: selection using 10-15 micrograms/mL strep.
It is MalE deficient, which enables maltose complementation. For the assay, a particular construct is transformed into MM39 and grown on maltose minimal media to confirm proper membrane orientation and integration.
Proper citation: RRID:Addgene_42894 Copy
Species:
Genetic Insert: tetR(sB)
Vector Backbone Description: Backbone Size:5127; Vector Backbone:pDE43-MCSq17; Vector Types:Bacterial Expression, Gateway Cloning; Bacterial Resistance:Streptomycin
References:
Comments:
Proper citation: RRID:Addgene_27364 Copy
Species:
Genetic Insert:
Vector Backbone Description: Vector Backbone:pHAtC; Vector Types:Plant Expression, Plant Binary vector; Bacterial Resistance:Streptomycin
References:
Comments:
Proper citation: RRID:Addgene_169766 Copy
Species: bacteria
Genetic Insert: Promotorless gfp reporter gene
Vector Backbone Description: Vector Backbone:pBBR1; Vector Types:; Bacterial Resistance:Streptomycin
References:
Comments: Please refer to the attached table for a complete list of restriction sites in the MCS.
Proper citation: RRID:Addgene_37821 Copy
Species:
Genetic Insert: pGH3.17::SMT2-FLAG
Vector Backbone Description: Vector Backbone:pYI001; Vector Types:Plant Expression; Bacterial Resistance:Streptomycin
References:
Comments: Please visit https://doi.org/10.1101/2021.06.16.448628 for bioRxiv preprint.
Proper citation: RRID:Addgene_170844 Copy
Species:
Genetic Insert: pUBQ10::SMT2-FLAG::tOCS
Vector Backbone Description: Vector Backbone:pFP100; Vector Types:Plant Expression; Bacterial Resistance:Streptomycin
References:
Comments: Please visit https://doi.org/10.1101/2021.06.16.448628 for bioRxiv preprint.
Proper citation: RRID:Addgene_170842 Copy
Species:
Genetic Insert: pFRO6::SMT2-FLAG
Vector Backbone Description: Vector Backbone:pYI001; Vector Types:Plant Expression; Bacterial Resistance:Streptomycin
References:
Comments: Please note that the Addgene verified sequence differs from the depositor reference sequence linked in the supplemental documents section. These differences did not impact plasmid function. The primers 5' - ATCCAAGCTCAAGCTAAGCTcgatgctctcaaggccaa and 3' -TATCTCATTAAAGCAGGATCCTCACTTGTCATCGTCGTCCTTGTAATCAGAACTCTCCTCCGGT were previously used, although the 5' primer differs slightly from the Addgene verified sequence.
Please visit https://doi.org/10.1101/2021.06.16.448628 for bioRxiv preprint.
Proper citation: RRID:Addgene_170843 Copy
Species:
Genetic Insert: GH3.17p
Vector Backbone Description: Vector Backbone:pYI001; Vector Types:Plant Expression; Bacterial Resistance:Streptomycin
References:
Comments: Please visit https://doi.org/10.1101/2021.06.16.448628 for bioRxiv preprint.
Proper citation: RRID:Addgene_170841 Copy
Species: Zea mays (maize)
Genetic Insert: NCH1
Vector Backbone Description: Backbone Size:11546; Vector Backbone:pH7WG2; Vector Types:Plant Expression; Bacterial Resistance:Streptomycin
References:
Comments:
Proper citation: RRID:Addgene_131017 Copy
Species: Synthetic
Genetic Insert: Cas9-sgRNA-homology arms
Vector Backbone Description: Vector Backbone:pJRD215; Vector Types:Bacterial Expression, CRISPR, broad-host-range; Bacterial Resistance:Streptomycin
References:
Comments: Please visit https://www.biorxiv.org/content/10.1101/2022.03.14.484339v1 for bioRxiv preprint.
Proper citation: RRID:Addgene_184908 Copy
Species:
Genetic Insert:
Vector Backbone Description: Vector Backbone:pUC; Vector Types:Bacterial Expression; Bacterial Resistance:Streptomycin
References:
Comments: Please note that Addgene's NGS found a 65bp insertion in the ori region as compared to the Depositor's sequence. The depositor has confirmed that the plasmid functions as described in the associated publication.
Proper citation: RRID:Addgene_188979 Copy
Species: Other
Genetic Insert: CRISPR array
Vector Backbone Description: Backbone Marker:PMID:26013814; Vector Backbone:pCDF-casBCDE; Vector Types:Bacterial Expression; Bacterial Resistance:Streptomycin
References:
Comments:
Proper citation: RRID:Addgene_89728 Copy
Species: Homo sapiens
Genetic Insert: MKK6
Vector Backbone Description: Backbone Size:3781; Vector Backbone:pCDFDuet-1; Vector Types:Bacterial Expression; Bacterial Resistance:Streptomycin
References:
Comments:
Proper citation: RRID:Addgene_82718 Copy
Species: Homo sapiens
Genetic Insert: MKK6
Vector Backbone Description: Backbone Size:3781; Vector Backbone:pCDFDuet-1; Vector Types:Bacterial Expression; Bacterial Resistance:Streptomycin
References:
Comments:
Proper citation: RRID:Addgene_82719 Copy
Can't find your Plasmid?
We recommend that you click next to the search bar to check some helpful tips on searches and refine your search firstly. If you want to find a specific plasmid, it's easier to enter an RRID or an Addgene Catalog Number to search. You can refine the search results using Facets on the left side of the search results page. If you are on the table view, you can also search in a specific column by clicking the column title and enter the keywords.
If you still could not find your plasmid in the search results, please help us by registering it into the system — it's easy. Register it with Addgene.
Welcome to the NIF Resources search. From here you can search through a compilation of resources used by NIF and see how data is organized within our community.
You are currently on the Community Resources tab looking through categories and sources that NIF has compiled. You can navigate through those categories from here or change to a different tab to execute your search through. Each tab gives a different perspective on data.
If you have an account on NIF then you can log in from here to get additional features in NIF such as Collections, Saved Searches, and managing Resources.
Here is the search term that is being executed, you can type in anything you want to search for. Some tips to help searching:
You can save any searches you perform for quick access to later from here.
We recognized your search term and included synonyms and inferred terms along side your term to help get the data you are looking for.
If you are logged into NIF you can add data records to your collections to create custom spreadsheets across multiple sources of data.
Here are the sources that were queried against in your search that you can investigate further.
Here are the categories present within NIF that you can filter your data on
Here are the subcategories present within this category that you can filter your data on
If you have any further questions please check out our FAQs Page to ask questions and see our tutorials. Click this button to view this tutorial again.
Welcome to the Neuroscience Information Framework Project, designed to serve the biomedical research community. NIF maintains the largest searchable collection of neuroscience data, the largest catalog of biomedical resources, and the largest ontology for neuroscience on the web. We welcome all feedback and suggestions and are actively looking for resource providers to make their resources accessible through NIF. Learn about the tools available to help you share your data and discover a dynamic inventory of Web-based neuroscience resources.
