Searching the RRID Resource Information Network
Are you sure you want to leave this community? Leaving the community will revoke any permissions you have been granted in this community.
Species:
Genetic Insert:
Vector Backbone Description: Backbone Size:4769; Vector Backbone:Unknown; Vector Types:Bacterial Expression, Synthetic Biology; Bacterial Resistance:Streptomycin
References:
Comments: Low copy plasmid (pSC101 ori and repA), pUC19 MCS with FLAG epitope integrated at SmaI site, confers streptomycin resistance
Proper citation: RRID:Addgene_225164 Copy
Species: Chryseobacterium sp. JM1
Genetic Insert: ChrH
Vector Backbone Description: Vector Backbone:pCDFDuet-1; Vector Types:Bacterial Expression; Bacterial Resistance:Streptomycin
References:
Comments: Also encodes ChrI (no tag)
Proper citation: RRID:Addgene_225083 Copy
Species:
Genetic Insert:
Vector Backbone Description: Backbone Size:5261; Vector Backbone:CloDF13; Vector Types:Bacterial Expression, Synthetic Biology; Bacterial Resistance:Streptomycin
References:
Comments:
Proper citation: RRID:Addgene_213132 Copy
Species:
Genetic Insert:
Vector Backbone Description: Vector Backbone:pUC; Vector Types:Bacterial Expression; Bacterial Resistance:Streptomycin
References:
Comments:
Proper citation: RRID:Addgene_188972 Copy
Species: E. coli
Genetic Insert: transcriptional regulator, OxyR, cognate promoter PoxyS, fluorescent protein sfGFP
Vector Backbone Description: Backbone Marker:https://seva-plasmids.com/; Backbone Size:2390; Vector Backbone:pSEVA-based; Vector Types:Bacterial Expression; Bacterial Resistance:Streptomycin
References:
Comments:
Proper citation: RRID:Addgene_194154 Copy
Species: E. coli
Genetic Insert: transcriptional regulator, OxyR, cognate promoter PoxyS, fluorescent protein mCherry
Vector Backbone Description: Backbone Marker:https://seva-plasmids.com/; Backbone Size:2754; Vector Backbone:pSEVA-based; Vector Types:Bacterial Expression; Bacterial Resistance:Streptomycin
References:
Comments:
Proper citation: RRID:Addgene_194155 Copy
Species:
Genetic Insert: Genotype: MC4100 ∆clpPX
Vector Backbone Description: Vector Backbone:none; Vector Types:; Bacterial Resistance:Streptomycin
References:
Comments: Strain DHL708 was built by deleting the clpPX operon with lambda-Red mediated homologous recombination. The FRT-flanked Kan cassette was then flipped out using the FLP recombinase (pCP20).
The deletion region can be PCR-amplified and sequenced using the primers CCGCTCGAGTTTACGCAGCATAACGCGCTAAATTC and CGTCAGTATATGGGGATGTTTCCCC.
Originally described in Landgraf, D., Okumus, B., Chien, P., Baker, T. A. & Paulsson, J. Segregation of molecules at cell division reveals native protein localization. Nat Methods 9, 480–482 (2012).
Proper citation: RRID:Addgene_98417 Copy
Species: E. coli
Genetic Insert: dnaQ
Vector Backbone Description: Vector Backbone:pCDFDuet; Vector Types:Bacterial Expression; Bacterial Resistance:Streptomycin
References:
Comments:
Proper citation: RRID:Addgene_241263 Copy
Species: Chryseobacterium sp. JM1
Genetic Insert: ChrH
Vector Backbone Description: Vector Backbone:pCDFDuet-1; Vector Types:Bacterial Expression; Bacterial Resistance:Streptomycin
References:
Comments: Please visit https://doi.org/10.1101/2025.10.31.685832 for bioRxiv preprint.
Proper citation: RRID:Addgene_257760 Copy
Species: Melainabacteria bacterium isolate SJ512
Genetic Insert: MelH
Vector Backbone Description: Vector Backbone:pCDFDuet-1; Vector Types:Bacterial Expression; Bacterial Resistance:Streptomycin
References:
Comments: Please visit https://doi.org/10.1101/2025.10.31.685832 for bioRxiv preprint.
Proper citation: RRID:Addgene_257765 Copy
Species: Hymenobacter gelipurpurascens DSM 11116
Genetic Insert: HymH
Vector Backbone Description: Vector Backbone:pCDFDuet-1; Vector Types:Bacterial Expression; Bacterial Resistance:Streptomycin
References:
Comments: Please visit https://doi.org/10.1101/2025.10.31.685832 for bioRxiv preprint.
Proper citation: RRID:Addgene_257763 Copy
Species: Neisseria dentiae CCUG 53898 310003
Genetic Insert: NedB and NedC
Vector Backbone Description: Vector Backbone:pCDFDuet-1; Vector Types:Bacterial Expression; Bacterial Resistance:Streptomycin
References:
Comments: Please visit https://doi.org/10.1101/2025.10.31.685832 for bioRxiv preprint.
Proper citation: RRID:Addgene_257772 Copy
Species: Saccharomyces cerevisiae
Genetic Insert: Sc RFC5 (mutant)
Vector Backbone Description: Vector Backbone:pCDFDuet; Vector Types:Bacterial Expression; Bacterial Resistance:Streptomycin
References:
Comments: Mix & Match (co-transform) with other vectors to over-express Sc RFC complex or related complexes (with Sc RFC1 substituted by Sc rad24, Sc ctf18, or Sc Elg1) containing the desired mutation(s). Expression in CodonPlus(RIL) or other strain containing rare Sc tRNA genes recommended.
Proper citation: RRID:Addgene_258210 Copy
Species: Melainabacteria bacterium isolate SJ512
Genetic Insert: His-MelH and MelHc
Vector Backbone Description: Vector Backbone:pCDFDuet-1; Vector Types:Bacterial Expression; Bacterial Resistance:Streptomycin
References:
Comments: Please visit https://doi.org/10.1101/2025.10.31.685832 for bioRxiv preprint.
Proper citation: RRID:Addgene_257767 Copy
Species: Synthetic
Genetic Insert: msfGFP
Vector Backbone Description: Backbone Size:4730; Vector Backbone:pBAMD1-4; Vector Types:Bacterial Expression; Bacterial Resistance:Streptomycin
References:
Comments:
Proper citation: RRID:Addgene_227664 Copy
Species: Vibrio cholera
Genetic Insert: VchTniQ, VchCas5/8, VchCas7, VchCas6, VchTnsABC, CRISPR(BsaI)
Vector Backbone Description: Vector Backbone:pCDFDuet-1; Vector Types:Bacterial Expression; Bacterial Resistance:Streptomycin
References:
Comments:
Proper citation: RRID:Addgene_190273 Copy
Species: Pseudomonas aeruginosa PA14
Genetic Insert: PaCas1, PaCas2-3
Vector Backbone Description: Backbone Size:2819; Vector Backbone:2S; Vector Types:Bacterial Expression; Bacterial Resistance:Streptomycin
References:
Comments:
Proper citation: RRID:Addgene_200216 Copy
Species: Pseudomonas aeruginosa PA14
Genetic Insert: PaCas1, PaCas2-3
Vector Backbone Description: Backbone Size:2819; Vector Backbone:2S; Vector Types:Bacterial Expression; Bacterial Resistance:Streptomycin
References:
Comments:
Proper citation: RRID:Addgene_200217 Copy
Species:
Genetic Insert: plasmid for adenine base editing; oriV(pRO1600/ColE1), xylS, Pm→repA, P14b→msfGFP; Pm→ ABE:SpRY, PEM7→non-specific sgRNA
Vector Backbone Description: Backbone Marker:SEVA collection; Vector Backbone:pSEVA448; Vector Types:CRISPR, Pseudomonas vector; Bacterial Resistance:Streptomycin
References:
Comments:
Proper citation: RRID:Addgene_207528 Copy
Species: Pseudomonas aeruginosa PA14
Genetic Insert: PaCas1, PaCas2-3
Vector Backbone Description: Backbone Size:2819; Vector Backbone:2S; Vector Types:Bacterial Expression; Bacterial Resistance:Streptomycin
References:
Comments:
Proper citation: RRID:Addgene_200218 Copy
Can't find your Plasmid?
We recommend that you click next to the search bar to check some helpful tips on searches and refine your search firstly. If you want to find a specific plasmid, it's easier to enter an RRID or an Addgene Catalog Number to search. You can refine the search results using Facets on the left side of the search results page. If you are on the table view, you can also search in a specific column by clicking the column title and enter the keywords.
If you still could not find your plasmid in the search results, please help us by registering it into the system — it's easy. Register it with Addgene.
Welcome to the NIF Resources search. From here you can search through a compilation of resources used by NIF and see how data is organized within our community.
You are currently on the Community Resources tab looking through categories and sources that NIF has compiled. You can navigate through those categories from here or change to a different tab to execute your search through. Each tab gives a different perspective on data.
If you have an account on NIF then you can log in from here to get additional features in NIF such as Collections, Saved Searches, and managing Resources.
Here is the search term that is being executed, you can type in anything you want to search for. Some tips to help searching:
You can save any searches you perform for quick access to later from here.
We recognized your search term and included synonyms and inferred terms along side your term to help get the data you are looking for.
If you are logged into NIF you can add data records to your collections to create custom spreadsheets across multiple sources of data.
Here are the sources that were queried against in your search that you can investigate further.
Here are the categories present within NIF that you can filter your data on
Here are the subcategories present within this category that you can filter your data on
If you have any further questions please check out our FAQs Page to ask questions and see our tutorials. Click this button to view this tutorial again.
Welcome to the Neuroscience Information Framework Project, designed to serve the biomedical research community. NIF maintains the largest searchable collection of neuroscience data, the largest catalog of biomedical resources, and the largest ontology for neuroscience on the web. We welcome all feedback and suggestions and are actively looking for resource providers to make their resources accessible through NIF. Learn about the tools available to help you share your data and discover a dynamic inventory of Web-based neuroscience resources.
