Searching the RRID Resource Information Network
Are you sure you want to leave this community? Leaving the community will revoke any permissions you have been granted in this community.
Species: Synthetic
Genetic Insert: Cas9
Vector Backbone Description: Vector Backbone:pCDNA3.1; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:33733873
Proper citation: RRID:Addgene_132553 Copy
Species: Homo sapiens
Genetic Insert: human miR-302 cluster: MIR302B, MIR302C, MIR302A, MIR302D, MIR367
Vector Backbone Description: Backbone Marker:Broad Insitute; Backbone Size:8405; Vector Backbone:pCW57-GFP-2A-MCS; Vector Types:Mammalian Expression, Lentiviral, Doxycycline inducible, microRNA expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:31673026
Comments: MIR302 cluster was PCR-amplified from genomic DNA using the following primers: Fwd - ACACCGGTGAAGTTGTATGTTGGGTGGGCT; Rev - CGTGTACACGTTATTTAACAATCCATCACCATTGCTAAAGT and cloned into pJET. pJET was digested using AgeI/BsrGI and inserted into AgeI/BsrGI digested pCW57-GFP-MCS vector (Addgene #71783).
Proper citation: RRID:Addgene_132549 Copy
Species: Synthetic
Genetic Insert: gRNA SLBP-based CIRTS
Vector Backbone Description: Vector Backbone:custom; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:31230714
Proper citation: RRID:Addgene_132548 Copy
Species: Synthetic
Genetic Insert: CIRTS-10: bdefensin 3-SLBP-YTHDF2(1-200)
Vector Backbone Description: Vector Backbone:cmv d0; Vector Types:Mammalian Expression; Bacterial Resistance:Kanamycin
Defining Citation: PMID:31230714
Proper citation: RRID:Addgene_132546 Copy
Species: Synthetic
Genetic Insert: CIRTS-1: ORF5-TBP6.7-Pin domain-NLS
Vector Backbone Description: Vector Backbone:cmv d0; Vector Types:Mammalian Expression; Bacterial Resistance:Kanamycin
Defining Citation: PMID:31230714
Proper citation: RRID:Addgene_132543 Copy
Species: Homo sapiens
Genetic Insert: DYNLRB1
Vector Backbone Description: Backbone Marker:Geneva Biotech; Backbone Size:2922; Vector Backbone:pACEBac1; Vector Types:Insect Expression; Bacterial Resistance:Gentamicin
Defining Citation: PMID:31451806
Comments: Cloned by Ruta Zalyte in Andrew Carter's lab. For cloning strategy, please refer to the Methods section of Toropova et al 2019.
Proper citation: RRID:Addgene_132533 Copy
Species: Homo sapiens
Genetic Insert: DYNLT3
Vector Backbone Description: Backbone Marker:Geneva Biotech; Backbone Size:2922; Vector Backbone:pACEBac1; Vector Types:Insect Expression; Bacterial Resistance:Gentamicin
Defining Citation: PMID:31451806
Comments: Cloned by Ruta Zalyte in Andrew Carter's lab. For cloning strategy, please refer to the Methods section of Toropova et al 2019.
Proper citation: RRID:Addgene_132532 Copy
Species: Homo sapiens
Genetic Insert: DYNLT1
Vector Backbone Description: Backbone Marker:Geneva Biotech; Backbone Size:2924; Vector Backbone:pACEBac1; Vector Types:Insect Expression; Bacterial Resistance:Gentamicin
Defining Citation: PMID:31451806
Comments: Cloned by Ruta Zalyte in Andrew Carter's lab. For cloning strategy, please refer to the Methods section of Toropova et al 2019.
Proper citation: RRID:Addgene_132528 Copy
Species: Homo sapiens
Genetic Insert: DYNC2LI1
Vector Backbone Description: Backbone Marker:Geneva Biotech; Backbone Size:2922; Vector Backbone:pACEBac1; Vector Types:Insect Expression; Bacterial Resistance:Gentamicin
Defining Citation: PMID:31451806
Comments: Cloned by Ruta Zalyte in Andrew Carter's lab. For cloning strategy, please refer to the Methods section of Toropova et al 2019.
Proper citation: RRID:Addgene_132527 Copy
Species: Homo sapiens
Genetic Insert: WDR34
Vector Backbone Description: Backbone Marker:Geneva Biotech; Backbone Size:2922; Vector Backbone:pACEBac1; Vector Types:Insect Expression; Bacterial Resistance:Gentamicin
Defining Citation: PMID:31451806
Comments: Cloned by Ruta Zalyte in Andrew Carter's lab. For cloning strategy, please refer to the Methods section of Toropova et al 2019.
Proper citation: RRID:Addgene_132526 Copy
Species: Caenorhabditis elegans
Genetic Insert: mNG-C1^SEC^3xFlag
Vector Backbone Description: Backbone Size:3881; Vector Backbone:pUC19 (modified); Vector Types:Worm Expression, Cre/Lox, CRISPR; Bacterial Resistance:Ampicillin
Defining Citation: PMID:26044593
Proper citation: RRID:Addgene_132523 Copy
Species: Homo sapiens
Genetic Insert: PATZ1
Vector Backbone Description: Vector Backbone:pUC19; Vector Types:CRISPR; Bacterial Resistance:Ampicillin and Kanamycin
Comments: Cloning source: SK-N-SH
Proper citation: RRID:Addgene_132522 Copy
Species: Mus musculus
Genetic Insert: Tankyrase1 (171–961)
Vector Backbone Description: Vector Backbone:pGEX-4T1; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:29604130
Proper citation: RRID:Addgene_132638 Copy
Species: Mus musculus
Genetic Insert: Tankyrase1 (308-655)
Vector Backbone Description: Vector Backbone:pGEX-4T1; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:22307604
Proper citation: RRID:Addgene_132637 Copy
Species: Synthetic
Genetic Insert: Lion1
Vector Backbone Description: Backbone Marker:IDT; Backbone Size:2761; Vector Backbone:pUCIDT-Amp; Vector Types:Unspecified; Bacterial Resistance:Ampicillin
Defining Citation: PMID:34112975
Proper citation: RRID:Addgene_132755 Copy
Species: Synthetic
Genetic Insert: Cat3
Vector Backbone Description: Backbone Marker:IDT; Backbone Size:2761; Vector Backbone:pUCIDT-Amp; Vector Types:Unspecified; Bacterial Resistance:Ampicillin
Defining Citation: PMID:34112975
Proper citation: RRID:Addgene_132754 Copy
Species: Synthetic
Genetic Insert: Cat1
Vector Backbone Description: Backbone Marker:IDT; Backbone Size:2761; Vector Backbone:pUCIDT-Amp; Vector Types:Unspecified; Bacterial Resistance:Ampicillin
Defining Citation: PMID:34112975
Proper citation: RRID:Addgene_132752 Copy
Species: Homo sapiens
Genetic Insert: APC-B,C (1133–1189)
Vector Backbone Description: Vector Backbone:pGEX-4T1; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:14600025
Proper citation: RRID:Addgene_132630 Copy
Species: Synthetic
Genetic Insert: Cherry1
Vector Backbone Description: Backbone Marker:IDT; Backbone Size:2761; Vector Backbone:pUCIDT-Amp; Vector Types:Unspecified; Bacterial Resistance:Ampicillin
Defining Citation: PMID:34112975
Proper citation: RRID:Addgene_132751 Copy
Species: Homo sapiens
Genetic Insert: L1CAM
Vector Backbone Description: Backbone Size:5450; Vector Backbone:pcDNA3; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:15647482
Proper citation: RRID:Addgene_13268 Copy
Can't find your Plasmid?
We recommend that you click next to the search bar to check some helpful tips on searches and refine your search firstly. If you want to find a specific plasmid, it's easier to enter an RRID or an Addgene Catalog Number to search. You can refine the search results using Facets on the left side of the search results page. If you are on the table view, you can also search in a specific column by clicking the column title and enter the keywords.
If you still could not find your plasmid in the search results, please help us by registering it into the system — it's easy. Register it with Addgene.
Welcome to the NIF Resources search. From here you can search through a compilation of resources used by NIF and see how data is organized within our community.
You are currently on the Community Resources tab looking through categories and sources that NIF has compiled. You can navigate through those categories from here or change to a different tab to execute your search through. Each tab gives a different perspective on data.
If you have an account on NIF then you can log in from here to get additional features in NIF such as Collections, Saved Searches, and managing Resources.
Here is the search term that is being executed, you can type in anything you want to search for. Some tips to help searching:
You can save any searches you perform for quick access to later from here.
We recognized your search term and included synonyms and inferred terms along side your term to help get the data you are looking for.
If you are logged into NIF you can add data records to your collections to create custom spreadsheets across multiple sources of data.
Here are the sources that were queried against in your search that you can investigate further.
Here are the categories present within NIF that you can filter your data on
Here are the subcategories present within this category that you can filter your data on
If you have any further questions please check out our FAQs Page to ask questions and see our tutorials. Click this button to view this tutorial again.
Welcome to the Neuroscience Information Framework Project, designed to serve the biomedical research community. NIF maintains the largest searchable collection of neuroscience data, the largest catalog of biomedical resources, and the largest ontology for neuroscience on the web. We welcome all feedback and suggestions and are actively looking for resource providers to make their resources accessible through NIF. Learn about the tools available to help you share your data and discover a dynamic inventory of Web-based neuroscience resources.
