Searching the RRID Resource Information Network

Our searching services are busy right now. Please try again later

  • Register
X
Forgot Password

If you have forgotten your password you can enter your email here and get a temporary password sent to your email.

X

Leaving Community

Are you sure you want to leave this community? Leaving the community will revoke any permissions you have been granted in this community.

No
Yes

Plasmids are provided by Addgene and DGRC.

Search

Type in a keyword to search

On page 483 showing 9641 ~ 9660 out of 742,877 results
Snippet view Table view Download Top 1000 Results
Click the to add this resource to a Collection
  • RRID:Addgene_176756

    This resource has 1+ mentions.

http://www.addgene.org/176756

Species: Rattus norvegicus
Genetic Insert: jGCaMP8f
Vector Backbone Description: Vector Backbone:AAV; Vector Types:Mammalian Expression, AAV; Bacterial Resistance:Ampicillin

Proper citation: RRID:Addgene_176756 Copy   


  • RRID:Addgene_17670

http://www.addgene.org/17670

Species: Gallus gallus
Genetic Insert: v-src
Vector Backbone Description: Backbone Size:6400; Vector Backbone:pEVX; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:2161957

Proper citation: RRID:Addgene_17670 Copy   


  • RRID:Addgene_17671

    This resource has 1+ mentions.

http://www.addgene.org/17671

Species: Mus musculus
Genetic Insert: Cx43
Vector Backbone Description: Backbone Size:0; Vector Backbone:pcDNA3.1/CT-GFP-TOPO; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Comments: Amino acids 234-243 deleted (tubulin binding site).

Proper citation: RRID:Addgene_17671 Copy   


  • RRID:Addgene_176751

    This resource has 1+ mentions.

http://www.addgene.org/176751

Species: Rattus norvegicus
Genetic Insert: jGCaMP8m
Vector Backbone Description: Vector Backbone:AAV; Vector Types:Mammalian Expression, AAV; Bacterial Resistance:Ampicillin

Proper citation: RRID:Addgene_176751 Copy   


  • RRID:Addgene_176750

    This resource has 1+ mentions.

http://www.addgene.org/176750

Species: Rattus norvegicus
Genetic Insert: jGCaMP8f
Vector Backbone Description: Vector Backbone:AAV; Vector Types:Mammalian Expression, AAV; Bacterial Resistance:Ampicillin

Proper citation: RRID:Addgene_176750 Copy   


http://www.addgene.org/176753

Species: Rattus norvegicus
Genetic Insert: jGCaMP8f
Vector Backbone Description: Vector Backbone:AAV; Vector Types:Mammalian Expression, AAV; Bacterial Resistance:Ampicillin

Proper citation: RRID:Addgene_176753 Copy   


  • RRID:Addgene_17676

http://www.addgene.org/17676

Species: Gallus gallus
Genetic Insert: c-src Y416F
Vector Backbone Description: Backbone Size:6400; Vector Backbone:pEVX; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:3103925
Comments: Based on plasmid pM5HHB5.

Proper citation: RRID:Addgene_17676 Copy   


  • RRID:Addgene_17678

    This resource has 1+ mentions.

http://www.addgene.org/17678

Species: Gallus gallus
Genetic Insert: c-src K295R
Vector Backbone Description: Backbone Size:6400; Vector Backbone:pEVX; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:1702522
Comments: Based on plasmid pM5HHB5.

Proper citation: RRID:Addgene_17678 Copy   


  • RRID:Addgene_17679

http://www.addgene.org/17679

Species: Gallus gallus
Genetic Insert: c-src K295R Y527F
Vector Backbone Description: Backbone Size:6400; Vector Backbone:pEVX; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:1702522
Comments: Based on plasmid pM5HHB5. This plasmid is unpublished, but related to this article.

Proper citation: RRID:Addgene_17679 Copy   


http://www.addgene.org/176748

Species: Rattus norvegicus
Genetic Insert: H2B-jGCaMP8m
Vector Backbone Description: Vector Backbone:AAV-Syn; Vector Types:Mammalian Expression, AAV; Bacterial Resistance:Ampicillin

Proper citation: RRID:Addgene_176748 Copy   


  • RRID:Addgene_17680

http://www.addgene.org/17680

Species: Gallus gallus
Genetic Insert: c-src S12A
Vector Backbone Description: Backbone Size:6400; Vector Backbone:pEVX; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:2474754
Comments: The pM5HHB5 c-src sequence between nucleotide 1 (numbering from the c-src translational initiator ATG) and nucleotide 43 (at an NaeI site) was replaced with the sequence ATGGGGAGTAGCAAGAGCAAGCCTAAGGATC CCGCTCAGCGCC in pcAlal2. This introduced MstII and BamHI restriction sites near nucleotides 25 and 29, respectively, and changed the AGC (Ser) 12 codon to GCT (Ala) codon yet preserved the remaining the c-src amino acid sequence.

Proper citation: RRID:Addgene_17680 Copy   


  • RRID:Addgene_17682

http://www.addgene.org/17682

Species: Gallus gallus
Genetic Insert: c-src S12A S17A
Vector Backbone Description: Backbone Size:6400; Vector Backbone:pEVX; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:2474754
Comments: Based on plasmid pM5HHB5.

Proper citation: RRID:Addgene_17682 Copy   


  • RRID:Addgene_17683

http://www.addgene.org/17683

Species: Gallus gallus
Genetic Insert: c-src S12A Y527F
Vector Backbone Description: Backbone Size:6400; Vector Backbone:pEVX; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:2474754
Comments: Based on plasmid pM5HHB5.

Proper citation: RRID:Addgene_17683 Copy   


  • RRID:Addgene_17684

http://www.addgene.org/17684

Species: Gallus gallus
Genetic Insert: c-src S17A Y527F
Vector Backbone Description: Backbone Size:6400; Vector Backbone:pEVX; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:2474754
Comments: Based on plasmid pM5HHB5.

Proper citation: RRID:Addgene_17684 Copy   


  • RRID:Addgene_17685

    This resource has 1+ mentions.

http://www.addgene.org/17685

Species: Mus musculus
Genetic Insert: c-src
Vector Backbone Description: Backbone Size:6400; Vector Backbone:pEVX; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:7530829

Proper citation: RRID:Addgene_17685 Copy   


  • RRID:Addgene_17686

    This resource has 1+ mentions.

http://www.addgene.org/17686

Species: Mus musculus
Genetic Insert: c-src Y529F
Vector Backbone Description: Backbone Size:6400; Vector Backbone:pEVX; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:7530829

Proper citation: RRID:Addgene_17686 Copy   


  • RRID:Addgene_176890

http://www.addgene.org/176890

Species: Lachnospiraceae bacterium ND2006
Genetic Insert: LbCas12a-E795L
Vector Backbone Description: Vector Backbone:pYPQ167; Vector Types:Plant Expression, CRISPR, Gateway compatible LbCpf1 entry clone; Bacterial Resistance:Spectinomycin
Defining Citation: PMID:35174354

Proper citation: RRID:Addgene_176890 Copy   


  • RRID:Addgene_176889

http://www.addgene.org/176889

Species: Acidaminococcus sp. BV3L6
Genetic Insert: AsCas12a
Vector Backbone Description: Vector Backbone:pYPQ167; Vector Types:Plant Expression, CRISPR, Gateway compatible Cas12a entry clone; Bacterial Resistance:Spectinomycin
Defining Citation: PMID:35174354

Proper citation: RRID:Addgene_176889 Copy   


http://www.addgene.org/176760

Species: Rattus norvegicus
Genetic Insert: lck-jGCaMP8m
Vector Backbone Description: Vector Backbone:pZac2.1; Vector Types:Mammalian Expression, AAV; Bacterial Resistance:Ampicillin

Proper citation: RRID:Addgene_176760 Copy   


http://www.addgene.org/176761

Species: Rattus norvegicus
Genetic Insert: lck-jGCaMP8s
Vector Backbone Description: Vector Backbone:pZac2.1; Vector Types:Mammalian Expression, AAV; Bacterial Resistance:Ampicillin

Proper citation: RRID:Addgene_176761 Copy   



Can't find your Plasmid?

We recommend that you click next to the search bar to check some helpful tips on searches and refine your search firstly. If you want to find a specific plasmid, it's easier to enter an RRID or an Addgene Catalog Number to search. You can refine the search results using Facets on the left side of the search results page. If you are on the table view, you can also search in a specific column by clicking the column title and enter the keywords.

If you still could not find your plasmid in the search results, please help us by registering it into the system — it's easy. Register it with Addgene.

Can't find the RRID you're searching for? X
  1. Neuroscience Information Framework Resources

    Welcome to the NIF Resources search. From here you can search through a compilation of resources used by NIF and see how data is organized within our community.

  2. Navigation

    You are currently on the Community Resources tab looking through categories and sources that NIF has compiled. You can navigate through those categories from here or change to a different tab to execute your search through. Each tab gives a different perspective on data.

  3. Logging in and Registering

    If you have an account on NIF then you can log in from here to get additional features in NIF such as Collections, Saved Searches, and managing Resources.

  4. Searching

    Here is the search term that is being executed, you can type in anything you want to search for. Some tips to help searching:

    1. Use quotes around phrases you want to match exactly
    2. You can manually AND and OR terms to change how we search between words
    3. You can add "-" to terms to make sure no results return with that term in them (ex. Cerebellum -CA1)
    4. You can add "+" to terms to require they be in the data
    5. Using autocomplete specifies which branch of our semantics you with to search and can help refine your search
  5. Save Your Search

    You can save any searches you perform for quick access to later from here.

  6. Query Expansion

    We recognized your search term and included synonyms and inferred terms along side your term to help get the data you are looking for.

  7. Collections

    If you are logged into NIF you can add data records to your collections to create custom spreadsheets across multiple sources of data.

  8. Sources

    Here are the sources that were queried against in your search that you can investigate further.

  9. Categories

    Here are the categories present within NIF that you can filter your data on

  10. Subcategories

    Here are the subcategories present within this category that you can filter your data on

  11. Further Questions

    If you have any further questions please check out our FAQs Page to ask questions and see our tutorials. Click this button to view this tutorial again.

X