Are you sure you want to leave this community? Leaving the community will revoke any permissions you have been granted in this community.
Genetic Insert: This is a strain.
Vector Backbone Description: Vector Backbone:Strain; Vector Types:; Bacterial Resistance:None
Defining Citation: PMID:35034449
Comments: Please visit https://www.biorxiv.org/content/10.1101/2021.09.07.459228v1 for bioRxiv preprint.
Primers for recBCD deletion verification:
Foward - ttgatttactgcccgagagc
Reverse - gtcaaccgaatgcagacatc
Proper citation: RRID:Addgene_176581 Copy
Vector Backbone Description: Vector Backbone:pUC19; Vector Types:Insect Expression, CRISPR; Bacterial Resistance:Ampicillin
Defining Citation: PMID:34819517
Comments: Cloning of sgRNA targeting sequence into BbsI cassette.
Please visit https://www.biorxiv.org/content/10.1101/2021.03.29.437496v2 for bioRxiv preprint.
Proper citation: RRID:Addgene_176658 Copy
Species: Mus musculus
Genetic Insert: mVenus-p27K-
Vector Backbone Description: Backbone Marker:System Biosciences; Backbone Size:7082; Vector Backbone:pCDH; Vector Types:Lentiviral; Bacterial Resistance:Ampicillin
Defining Citation: PMID:34079127
Proper citation: RRID:Addgene_176651 Copy
Vector Backbone Description: Vector Backbone:pUC19; Vector Types:Insect Expression, CRISPR; Bacterial Resistance:Ampicillin
Defining Citation: PMID:34819517
Comments: Cloning of sgRNA targeting sequence into BbsI cassette.
Please visit https://www.biorxiv.org/content/10.1101/2021.03.29.437496v2 for bioRxiv preprint.
Proper citation: RRID:Addgene_176653 Copy
Vector Backbone Description: Vector Backbone:pUC19; Vector Types:Insect Expression, CRISPR; Bacterial Resistance:Ampicillin
Defining Citation: PMID:34819517
Comments: Cloning of sgRNA targeting sequence into BbsI cassette.
Please visit https://www.biorxiv.org/content/10.1101/2021.03.29.437496v2 for bioRxiv preprint.
Proper citation: RRID:Addgene_176656 Copy
Vector Backbone Description: Vector Backbone:pUC19; Vector Types:Insect Expression, CRISPR; Bacterial Resistance:Ampicillin
Defining Citation: PMID:34819517
Comments: Cloning of sgRNA targeting sequence into BbsI cassette.
Please visit https://www.biorxiv.org/content/10.1101/2021.03.29.437496v2 for bioRxiv preprint.
Proper citation: RRID:Addgene_176655 Copy
Genetic Insert: lac I-SceI tet
Vector Backbone Description: Backbone Marker:Stratagene; Backbone Size:3000; Vector Backbone:pBluescript; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:17486118
Comments: The 256 lac operator repeats (XhoI fragment) and the 96 tet operator repeats (XhoI –SacII fragment) from the p16PCbeta
plasmid (gift from D. Spector) were cloned into pBluescript. Between the two fragments a single 18nt I-SceI site was inserted (SalI).
lac operator repeat: tggaattgtgagcggataacaatt
tet operator repeat: tccctatcagtgatagaga
This plasmid is not stable in bacteria. Every bacterial stock made will contain correct and incorrect bacteria and when bacteria are grown, you will get colonies which contain the correct plasmid and others which contain recombinant versions. If you check multiple colonies (10-20) in the samples after streaking out a stab, you should find correct ones. The recipient will need to grow the bacteria, isolate individual colonies check them, and make a prep from the correct one. We recommend processing the stab and screening colonies immediately upon receipt.
Proper citation: RRID:Addgene_17655 Copy
Species: Homo sapiens
Genetic Insert: UBF
Vector Backbone Description: Backbone Marker:Clontech; Backbone Size:4730; Vector Backbone:pEGFP-C1; Vector Types:Mammalian Expression; Bacterial Resistance:Kanamycin
Defining Citation: PMID:12446911
Proper citation: RRID:Addgene_17656 Copy
Species: Homo sapiens
Genetic Insert: RPA40
Vector Backbone Description: Backbone Marker:Clontech; Backbone Size:4730; Vector Backbone:pEGFP-N3; Vector Types:Mammalian Expression; Bacterial Resistance:Kanamycin
Defining Citation: PMID:12446911
Proper citation: RRID:Addgene_17658 Copy
Species: Synthetic
Genetic Insert: N-terminus of PE2
Vector Backbone Description: Backbone Size:3544; Vector Backbone:px601; Vector Types:Mammalian Expression, AAV; Bacterial Resistance:Ampicillin
Defining Citation: PMID:34446856
Proper citation: RRID:Addgene_176649 Copy
Species: Mus musculus
Genetic Insert: RPA194
Vector Backbone Description: Backbone Size:4730; Vector Backbone:modified pEGFP-C2; Vector Types:Mammalian Expression; Bacterial Resistance:Kanamycin
Defining Citation: PMID:12446911
Proper citation: RRID:Addgene_17660 Copy
Species: Homo sapiens
Genetic Insert: RRN3/TIF1A
Vector Backbone Description: Backbone Marker:Clontech; Backbone Size:4730; Vector Backbone:pEGFP-C1; Vector Types:Mammalian Expression; Bacterial Resistance:Kanamycin
Defining Citation: PMID:12446911
Comments: Please note: This plasmid contains a F236L mutation in RRN3 compared to the NCBI reference sequence. It is not known how this mutation affects plasmid function.
Proper citation: RRID:Addgene_17661 Copy
Species: Homo sapiens
Genetic Insert: GFP-lamin A
Vector Backbone Description: Backbone Size:5200; Vector Backbone:pBABE-puro; Vector Types:Mammalian Expression, Retroviral; Bacterial Resistance:Ampicillin
Defining Citation: PMID:18311132
Comments: This vector was generated by cloning the NheI–BamHI fragment from pEGFP–wt-lamin A into the BamHI site of the pBABE-puro vector after filling of the ends.
Proper citation: RRID:Addgene_17662 Copy
Species: Synthetic
Genetic Insert: MBP-RGG-LgBit-RGG
Vector Backbone Description: Vector Backbone:pBamUK; Vector Types:Bacterial Expression; Bacterial Resistance:Kanamycin
Defining Citation: PMID:34648259
Proper citation: RRID:Addgene_176643 Copy
Species: Homo sapiens
Genetic Insert: GFP-D50 lamin A
Vector Backbone Description: Backbone Size:5200; Vector Backbone:pBABE-puro; Vector Types:Mammalian Expression, Retroviral; Bacterial Resistance:Ampicillin
Defining Citation: PMID:18311132
Comments: This vector was generated by cloning the NheI–BamHI fragment from pEGFP–D50 lamin A into the BamHI site of the pBABE-puro vector after filling of the ends.
This plasmid exists as a dimer in our stock. Dimerziation often does not impact plasmid function, but may reduce transformation efficiencies. If you need the monomeric version, you could try linearizing, gel extracting, re-ligating, and transforming the plasmid.
Proper citation: RRID:Addgene_17663 Copy
Vector Backbone Description: Backbone Size:4888; Vector Backbone:pBABE-zeo; Vector Types:Mammalian Expression, Retroviral; Bacterial Resistance:Ampicillin
Defining Citation: PMID:2194165
Comments: Please acknowledge Jay Morgenstern and Hartmut Land and cite the following article if you use this plasmid in a publication:
Morgenstern JP, Land H., 1990, Nucleic Acids Research 18(12):3587-96.
SspI site in Amp gene.
If you are using the pBABE protocol from the Weinberg Lab to generate virus, please note that the Weinberg Lab recommends using pUMVC (Addgene #8449) and VSV-G (#8454) for packaging. The pCL-Eco plasmid listed in their protocol should be substituted with pUMVC.
Proper citation: RRID:Addgene_1766 Copy
Species: Mus musculus
Genetic Insert: Cx43 CT
Vector Backbone Description: Backbone Marker:Sigma; Backbone Size:3800; Vector Backbone:p3XFLAG-CMV-7.1?; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Proper citation: RRID:Addgene_17664 Copy
Species: Mus musculus
Genetic Insert: Cx43 3'UTR
Vector Backbone Description: Backbone Size:0; Vector Backbone:na; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin
Comments: 3'UTR of Mus musculus Gja1 (Cx43). For in situ riboprobe.
Anti-Sense: use SP6 and cut with ClaI.
Sense: use T7 and cut with HindIII.
Proper citation: RRID:Addgene_17665 Copy
Species: Mus musculus
Genetic Insert: Cx43 promoter
Vector Backbone Description: Backbone Size:7000; Vector Backbone:pPD46.20; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin
Proper citation: RRID:Addgene_17667 Copy
Species: Synthetic
Genetic Insert: eCFP
Vector Backbone Description: Vector Backbone:pK; Vector Types:Yeast Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:31367038
Proper citation: RRID:Addgene_176559 Copy
Can't find your Plasmid?
We recommend that you click next to the search bar to check some helpful tips on searches and refine your search firstly. If you want to find a specific plasmid, it's easier to enter an RRID or an Addgene Catalog Number to search. You can refine the search results using Facets on the left side of the search results page. If you are on the table view, you can also search in a specific column by clicking the column title and enter the keywords.
If you still could not find your plasmid in the search results, please help us by registering it into the system — it's easy. Register it with Addgene.
Welcome to the NIF Resources search. From here you can search through a compilation of resources used by NIF and see how data is organized within our community.
You are currently on the Community Resources tab looking through categories and sources that NIF has compiled. You can navigate through those categories from here or change to a different tab to execute your search through. Each tab gives a different perspective on data.
If you have an account on NIF then you can log in from here to get additional features in NIF such as Collections, Saved Searches, and managing Resources.
Here is the search term that is being executed, you can type in anything you want to search for. Some tips to help searching:
You can save any searches you perform for quick access to later from here.
We recognized your search term and included synonyms and inferred terms along side your term to help get the data you are looking for.
If you are logged into NIF you can add data records to your collections to create custom spreadsheets across multiple sources of data.
Here are the sources that were queried against in your search that you can investigate further.
Here are the categories present within NIF that you can filter your data on
Here are the subcategories present within this category that you can filter your data on
If you have any further questions please check out our FAQs Page to ask questions and see our tutorials. Click this button to view this tutorial again.