Searching the RRID Resource Information Network
Are you sure you want to leave this community? Leaving the community will revoke any permissions you have been granted in this community.
| Plasmid Name | Proper Citation | Insert Name | Organism | Bacterial Resistance | Defining Citation |
Comments |
||||
|---|---|---|---|---|---|---|---|---|---|---|
|
pcDNA3.1(-)-EGFP-AP4-mito Resource Report Resource Website |
RRID:Addgene_229693 | EGFP; Control construct with tandem AP4 motifs (mitochondria) | Listeria monocytogenes | Ampicillin | PMID:16371509 | Backbone Size:5401; Vector Backbone:pcDNA 3.1(-) ; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin | 2026-09-12 02:42:39 | 0 | ||
|
pJBL7054 Resource Report Resource Website |
RRID:Addgene_167223 | pCue-sfGFP | Other | Ampicillin | Vector Backbone:pUC19; Vector Types:Synthetic Biology; Bacterial Resistance:Ampicillin | 2026-09-12 02:42:40 | 0 | |||
|
pJBL7053 Resource Report Resource Website 1+ mentions |
RRID:Addgene_167222 | pPbr-sfGFP | Other | Ampicillin | Vector Backbone:pUC19; Vector Types:Synthetic Biology; Bacterial Resistance:Ampicillin | 2026-09-12 02:42:40 | 2 | |||
|
pJBL7058 Resource Report Resource Website |
RRID:Addgene_167227 | J23119-AKSIRV | Other | Chloramphenicol | Vector Backbone:pUC19; Vector Types:Synthetic Biology; Bacterial Resistance:Chloramphenicol | 2026-09-12 02:42:40 | 0 | |||
|
pJBL7057 Resource Report Resource Website |
RRID:Addgene_167226 | pIRH-sfGFP | Other | Kanamycin | Vector Backbone:pJL1; Vector Types:Synthetic Biology; Bacterial Resistance:Kanamycin | 2026-09-12 02:42:40 | 0 | |||
|
pJBL7043 Resource Report Resource Website |
RRID:Addgene_167214 | ArsR EP3 | Other | Kanamycin | https://pubs.acs.org/doi/full/10.1021/acs.est.5b00832?src=recsys | Vector Backbone:pJL1; Vector Types:Bacterial Expression; Bacterial Resistance:Kanamycin | 2026-09-12 02:42:40 | 0 | ||
|
pJBL7042 Resource Report Resource Website |
RRID:Addgene_167213 | MerR | Other | Kanamycin | Vector Backbone:pJL1; Vector Types:Bacterial Expression; Bacterial Resistance:Kanamycin | 2026-09-12 02:42:40 | 0 | |||
|
pJBL7049 Resource Report Resource Website |
RRID:Addgene_167219 | pArs-sfGFP | Other | Ampicillin | Vector Backbone:pUC19; Vector Types:Synthetic Biology; Bacterial Resistance:Ampicillin | 2026-09-12 02:42:40 | 0 | |||
|
pGMβ1 Resource Report Resource Website |
RRID:Addgene_216202 | Ampicillin | PMID:35036250 | https://doi.org/10.1016/j.idairyj.2023.105827 Lactobacillus delbrueckii subsp. bulgaricus OLL1073R-1 eps gene knockout mutants reduced exopolysaccharide synthesis and immunomodulatory activities | Backbone Marker:pAMbeta1 from Enterococcus faecalis (gram positive) and pGEM-Teasy from E. coli; Backbone Size:30831; Vector Backbone:pAMbeta1 and pGEM-Teasy; Vector Types:Bacterial Expression, Shuttle vector, Conjugal plasmid, theta type replication in lactic acid bacteria; Bacterial Resistance:Ampicillin | 2026-09-12 02:42:40 | 0 | |||
|
pGH394 Resource Report Resource Website |
RRID:Addgene_230851 | rAPOBEC1-dCas9 | Ampicillin | PMID:40613705 | Please visit https://doi.org/10.1101/2024.11.18.621003 for the bioRxiv preprint. | Vector Backbone:pGH125; Vector Types:Mammalian Expression, Lentiviral; Bacterial Resistance:Ampicillin | 2026-09-12 02:42:39 | 0 | ||
|
pJBL7076 Resource Report Resource Website |
RRID:Addgene_167241 | pT7-XylE | Other | Kanamycin | Vector Backbone:pJL1; Vector Types:Synthetic Biology; Bacterial Resistance:Kanamycin | 2026-09-12 02:42:40 | 0 | |||
|
pT7RNAPNev-FSR22 Resource Report Resource Website |
RRID:Addgene_216338 | T7RNAPN-FSR22 fusion | Synthetic | Kanamycin | Vector Backbone:pUC18; Vector Types:Bacterial Expression; Bacterial Resistance:Kanamycin | 2026-09-12 02:42:40 | 0 | |||
|
pLaG2-T7RNAPC Resource Report Resource Website |
RRID:Addgene_216337 | LaG2-T7RNAPC fusion | Synthetic | Kanamycin | Vector Backbone:pUC18; Vector Types:Bacterial Expression; Bacterial Resistance:Kanamycin | g2658a, g3915a | 2026-09-12 02:42:40 | 0 | ||
|
pJBL7066 Resource Report Resource Website |
RRID:Addgene_167235 | pMer-AKSIRV | Other | Ampicillin | Vector Backbone:pUC19; Vector Types:Synthetic Biology; Bacterial Resistance:Ampicillin | 2026-09-12 02:42:40 | 0 | |||
|
pJBL7070 Resource Report Resource Website |
RRID:Addgene_167239 | pT7-sfGFP-MGA | Other | Kanamycin | Vector Backbone:pJL1; Vector Types:Synthetic Biology; Bacterial Resistance:Kanamycin | 2026-09-12 02:42:40 | 0 | |||
|
pJBL7069 Resource Report Resource Website |
RRID:Addgene_167238 | J23119-sfGFP-MGA | Other | Ampicillin | Vector Backbone:pUC19; Vector Types:Synthetic Biology; Bacterial Resistance:Ampicillin | 2026-09-12 02:42:40 | 0 | |||
|
C-5545 ∆cosδε Resource Report Resource Website |
RRID:Addgene_209018 | Deficient in the P2 bacteriophage packaging cos site; rhamnose-inducible P4 delta (δ) and epsilon (ε) genes | Escherichia coli | Hygromycin | PMID:33317264 | P2 bacteriophage lysogen derived from E. coli EMG C-5545 strain. We designed a pair of primers to check the presence of P2 lysogen in this strain: - P2 gpH C-ter gpG Fw: 5’ GCAGAGCACGAACAGTCACG 3’ - P2 gpH C-ter gpG Rv: 5’ TTATTGCGGCATTTCCGGCC 3’ These primers amplify the C-terminal region of the P2 gpH gene (tail fiber) and the complete gpG gene (tail fiber chaperone) (PCR fragment size: 2070 bp). | Vector Backbone:n/a; Vector Types:; Bacterial Resistance:Hygromycin | 2026-09-12 02:42:40 | 0 | |
|
2M-T_Mce3R Resource Report Resource Website |
RRID:Addgene_225726 | mce3R | Mycobacterium tuberculosis | Ampicillin | PMID:39545866 | There are a couple of discrepancies in the sequence compared to the reference, but the depositor has confirmed that they do not affect plasmid function. 3bp indel in insert immediately following TEV site 8bp indel C-terminal of insert | Vector Backbone:pET; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin | 2026-09-12 02:42:40 | 0 | |
|
pET28b-MelG Resource Report Resource Website |
RRID:Addgene_225729 | melG | Mycobacterium tuberculosis | Kanamycin | PMID:39545866 | Vector Backbone:pET; Vector Types:Bacterial Expression; Bacterial Resistance:Kanamycin | 2026-09-12 02:42:40 | 0 | ||
|
pNY-347 Resource Report Resource Website 1+ mentions |
RRID:Addgene_231047 | anti GFP DARPin fused to mouse Fc | Mus musculus | Ampicillin | Vector Backbone:pRK5; Vector Types:Mammalian Expression, Affinity Reagent/ Antibody; Bacterial Resistance:Ampicillin | 2026-09-12 02:42:40 | 1 |
Can't find your Plasmid?
We recommend that you click next to the search bar to check some helpful tips on searches and refine your search firstly. If you want to find a specific plasmid, it's easier to enter an RRID or an Addgene Catalog Number to search. You can refine the search results using Facets on the left side of the search results page. If you are on the table view, you can also search in a specific column by clicking the column title and enter the keywords.
If you still could not find your plasmid in the search results, please help us by registering it into the system — it's easy. Register it with Addgene.
Welcome to the NIF Resources search. From here you can search through a compilation of resources used by NIF and see how data is organized within our community.
You are currently on the Community Resources tab looking through categories and sources that NIF has compiled. You can navigate through those categories from here or change to a different tab to execute your search through. Each tab gives a different perspective on data.
If you have an account on NIF then you can log in from here to get additional features in NIF such as Collections, Saved Searches, and managing Resources.
Here is the search term that is being executed, you can type in anything you want to search for. Some tips to help searching:
If you are logged into NIF you can add data records to your collections to create custom spreadsheets across multiple sources of data.
Here are the facets that you can filter the data by.
If you have any further questions please check out our FAQs Page to ask questions and see our tutorials. Click this button to view this tutorial again.
Welcome to the Neuroscience Information Framework Project, designed to serve the biomedical research community. NIF maintains the largest searchable collection of neuroscience data, the largest catalog of biomedical resources, and the largest ontology for neuroscience on the web. We welcome all feedback and suggestions and are actively looking for resource providers to make their resources accessible through NIF. Learn about the tools available to help you share your data and discover a dynamic inventory of Web-based neuroscience resources.
