Searching the RRID Resource Information Network

Our searching services are busy right now. Please try again later

  • Register
X
Forgot Password

If you have forgotten your password you can enter your email here and get a temporary password sent to your email.

X

Leaving Community

Are you sure you want to leave this community? Leaving the community will revoke any permissions you have been granted in this community.

No
Yes

Plasmids are provided by Addgene and DGRC.

Search

Type in a keyword to search

On page 479 showing 9561 ~ 9580 out of 742,877 results
Snippet view Table view Download Top 1000 Results
Click the to add this resource to a Collection

http://www.addgene.org/229693

Species: Listeria monocytogenes
Genetic Insert: EGFP; Control construct with tandem AP4 motifs (mitochondria)
Vector Backbone Description: Backbone Size:5401; Vector Backbone:pcDNA 3.1(-) ; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:16371509

Proper citation: RRID:Addgene_229693 Copy   


  • RRID:Addgene_167223

http://www.addgene.org/167223

Species: Other
Genetic Insert: pCue-sfGFP
Vector Backbone Description: Vector Backbone:pUC19; Vector Types:Synthetic Biology; Bacterial Resistance:Ampicillin

Proper citation: RRID:Addgene_167223 Copy   


  • RRID:Addgene_167222

    This resource has 1+ mentions.

http://www.addgene.org/167222

Species: Other
Genetic Insert: pPbr-sfGFP
Vector Backbone Description: Vector Backbone:pUC19; Vector Types:Synthetic Biology; Bacterial Resistance:Ampicillin

Proper citation: RRID:Addgene_167222 Copy   


  • RRID:Addgene_167227

http://www.addgene.org/167227

Species: Other
Genetic Insert: J23119-AKSIRV
Vector Backbone Description: Vector Backbone:pUC19; Vector Types:Synthetic Biology; Bacterial Resistance:Chloramphenicol

Proper citation: RRID:Addgene_167227 Copy   


  • RRID:Addgene_167226

http://www.addgene.org/167226

Species: Other
Genetic Insert: pIRH-sfGFP
Vector Backbone Description: Vector Backbone:pJL1; Vector Types:Synthetic Biology; Bacterial Resistance:Kanamycin

Proper citation: RRID:Addgene_167226 Copy   


  • RRID:Addgene_167214

http://www.addgene.org/167214

Species: Other
Genetic Insert: ArsR EP3
Vector Backbone Description: Vector Backbone:pJL1; Vector Types:Bacterial Expression; Bacterial Resistance:Kanamycin
Comments: https://pubs.acs.org/doi/full/10.1021/acs.est.5b00832?src=recsys

Proper citation: RRID:Addgene_167214 Copy   


  • RRID:Addgene_167213

http://www.addgene.org/167213

Species: Other
Genetic Insert: MerR
Vector Backbone Description: Vector Backbone:pJL1; Vector Types:Bacterial Expression; Bacterial Resistance:Kanamycin

Proper citation: RRID:Addgene_167213 Copy   


  • RRID:Addgene_167219

http://www.addgene.org/167219

Species: Other
Genetic Insert: pArs-sfGFP
Vector Backbone Description: Vector Backbone:pUC19; Vector Types:Synthetic Biology; Bacterial Resistance:Ampicillin

Proper citation: RRID:Addgene_167219 Copy   


  • RRID:Addgene_216202

http://www.addgene.org/216202

Vector Backbone Description: Backbone Marker:pAMbeta1 from Enterococcus faecalis (gram positive) and pGEM-Teasy from E. coli; Backbone Size:30831; Vector Backbone:pAMbeta1 and pGEM-Teasy; Vector Types:Bacterial Expression, Shuttle vector, Conjugal plasmid, theta type replication in lactic acid bacteria; Bacterial Resistance:Ampicillin
Defining Citation: PMID:35036250
Comments: https://doi.org/10.1016/j.idairyj.2023.105827 Lactobacillus delbrueckii subsp. bulgaricus OLL1073R-1 eps gene knockout mutants reduced exopolysaccharide synthesis and immunomodulatory activities

Proper citation: RRID:Addgene_216202 Copy   


  • RRID:Addgene_230851

http://www.addgene.org/230851

Genetic Insert: rAPOBEC1-dCas9
Vector Backbone Description: Vector Backbone:pGH125; Vector Types:Mammalian Expression, Lentiviral; Bacterial Resistance:Ampicillin
Defining Citation: PMID:40613705
Comments: Please visit https://doi.org/10.1101/2024.11.18.621003 for the bioRxiv preprint.

Proper citation: RRID:Addgene_230851 Copy   


  • RRID:Addgene_167241

http://www.addgene.org/167241

Species: Other
Genetic Insert: pT7-XylE
Vector Backbone Description: Vector Backbone:pJL1; Vector Types:Synthetic Biology; Bacterial Resistance:Kanamycin

Proper citation: RRID:Addgene_167241 Copy   


  • RRID:Addgene_216338

http://www.addgene.org/216338

Species: Synthetic
Genetic Insert: T7RNAPN-FSR22 fusion
Vector Backbone Description: Vector Backbone:pUC18; Vector Types:Bacterial Expression; Bacterial Resistance:Kanamycin

Proper citation: RRID:Addgene_216338 Copy   


  • RRID:Addgene_216337

http://www.addgene.org/216337

Species: Synthetic
Genetic Insert: LaG2-T7RNAPC fusion
Vector Backbone Description: Vector Backbone:pUC18; Vector Types:Bacterial Expression; Bacterial Resistance:Kanamycin

Proper citation: RRID:Addgene_216337 Copy   


  • RRID:Addgene_167235

http://www.addgene.org/167235

Species: Other
Genetic Insert: pMer-AKSIRV
Vector Backbone Description: Vector Backbone:pUC19; Vector Types:Synthetic Biology; Bacterial Resistance:Ampicillin

Proper citation: RRID:Addgene_167235 Copy   


  • RRID:Addgene_167239

http://www.addgene.org/167239

Species: Other
Genetic Insert: pT7-sfGFP-MGA
Vector Backbone Description: Vector Backbone:pJL1; Vector Types:Synthetic Biology; Bacterial Resistance:Kanamycin

Proper citation: RRID:Addgene_167239 Copy   


  • RRID:Addgene_167238

http://www.addgene.org/167238

Species: Other
Genetic Insert: J23119-sfGFP-MGA
Vector Backbone Description: Vector Backbone:pUC19; Vector Types:Synthetic Biology; Bacterial Resistance:Ampicillin

Proper citation: RRID:Addgene_167238 Copy   


  • RRID:Addgene_209018

http://www.addgene.org/209018

Species: Escherichia coli
Genetic Insert: Deficient in the P2 bacteriophage packaging cos site; rhamnose-inducible P4 delta (δ) and epsilon (ε) genes
Vector Backbone Description: Vector Backbone:n/a; Vector Types:; Bacterial Resistance:Hygromycin
Defining Citation: PMID:33317264
Comments: P2 bacteriophage lysogen derived from E. coli EMG C-5545 strain. We designed a pair of primers to check the presence of P2 lysogen in this strain: - P2 gpH C-ter gpG Fw: 5’ GCAGAGCACGAACAGTCACG 3’ - P2 gpH C-ter gpG Rv: 5’ TTATTGCGGCATTTCCGGCC 3’ These primers amplify the C-terminal region of the P2 gpH gene (tail fiber) and the complete gpG gene (tail fiber chaperone) (PCR fragment size: 2070 bp).

Proper citation: RRID:Addgene_209018 Copy   


  • RRID:Addgene_225726

http://www.addgene.org/225726

Species: Mycobacterium tuberculosis
Genetic Insert: mce3R
Vector Backbone Description: Vector Backbone:pET; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:39545866
Comments: There are a couple of discrepancies in the sequence compared to the reference, but the depositor has confirmed that they do not affect plasmid function. 3bp indel in insert immediately following TEV site 8bp indel C-terminal of insert

Proper citation: RRID:Addgene_225726 Copy   


  • RRID:Addgene_225729

http://www.addgene.org/225729

Species: Mycobacterium tuberculosis
Genetic Insert: melG
Vector Backbone Description: Vector Backbone:pET; Vector Types:Bacterial Expression; Bacterial Resistance:Kanamycin
Defining Citation: PMID:39545866

Proper citation: RRID:Addgene_225729 Copy   


  • RRID:Addgene_231047

    This resource has 1+ mentions.

http://www.addgene.org/231047

Species: Mus musculus
Genetic Insert: anti GFP DARPin fused to mouse Fc
Vector Backbone Description: Vector Backbone:pRK5; Vector Types:Mammalian Expression, Affinity Reagent/ Antibody; Bacterial Resistance:Ampicillin

Proper citation: RRID:Addgene_231047 Copy   



Can't find your Plasmid?

We recommend that you click next to the search bar to check some helpful tips on searches and refine your search firstly. If you want to find a specific plasmid, it's easier to enter an RRID or an Addgene Catalog Number to search. You can refine the search results using Facets on the left side of the search results page. If you are on the table view, you can also search in a specific column by clicking the column title and enter the keywords.

If you still could not find your plasmid in the search results, please help us by registering it into the system — it's easy. Register it with Addgene.

Can't find the RRID you're searching for? X
  1. Neuroscience Information Framework Resources

    Welcome to the NIF Resources search. From here you can search through a compilation of resources used by NIF and see how data is organized within our community.

  2. Navigation

    You are currently on the Community Resources tab looking through categories and sources that NIF has compiled. You can navigate through those categories from here or change to a different tab to execute your search through. Each tab gives a different perspective on data.

  3. Logging in and Registering

    If you have an account on NIF then you can log in from here to get additional features in NIF such as Collections, Saved Searches, and managing Resources.

  4. Searching

    Here is the search term that is being executed, you can type in anything you want to search for. Some tips to help searching:

    1. Use quotes around phrases you want to match exactly
    2. You can manually AND and OR terms to change how we search between words
    3. You can add "-" to terms to make sure no results return with that term in them (ex. Cerebellum -CA1)
    4. You can add "+" to terms to require they be in the data
    5. Using autocomplete specifies which branch of our semantics you with to search and can help refine your search
  5. Save Your Search

    You can save any searches you perform for quick access to later from here.

  6. Query Expansion

    We recognized your search term and included synonyms and inferred terms along side your term to help get the data you are looking for.

  7. Collections

    If you are logged into NIF you can add data records to your collections to create custom spreadsheets across multiple sources of data.

  8. Sources

    Here are the sources that were queried against in your search that you can investigate further.

  9. Categories

    Here are the categories present within NIF that you can filter your data on

  10. Subcategories

    Here are the subcategories present within this category that you can filter your data on

  11. Further Questions

    If you have any further questions please check out our FAQs Page to ask questions and see our tutorials. Click this button to view this tutorial again.

X