Searching the RRID Resource Information Network
Are you sure you want to leave this community? Leaving the community will revoke any permissions you have been granted in this community.
Species: Homo sapiens
Genetic Insert: CTNNA1 (alpha-catenin) Human
Vector Backbone Description: Backbone Size:4009; Vector Backbone:pEGFP-C1; Vector Types:Mammalian Expression; Bacterial Resistance:Kanamycin
Defining Citation: PMID:37480844
Proper citation: RRID:Addgene_229705 Copy
Species: Homo sapiens
Genetic Insert: RPL36 homology arms with XTEN80-mEGFP-3xHA for insertion at C terminus
Vector Backbone Description: Backbone Marker:Twist Biosciences; Vector Backbone:pTwist Amp High Copy; Vector Types:CRISPR; Bacterial Resistance:Ampicillin
Defining Citation: PMID:39742809
Proper citation: RRID:Addgene_227923 Copy
Species: Homo sapiens
Genetic Insert: CTNNA1 (alpha-catenin) Human
Vector Backbone Description: Backbone Size:4009; Vector Backbone:pEGFP-C1; Vector Types:Mammalian Expression; Bacterial Resistance:Kanamycin
Defining Citation: PMID:37480844
Proper citation: RRID:Addgene_229704 Copy
Species: Homo sapiens
Genetic Insert: YWHAQ homology arms with XTEN80-mEGFP-3xHA for insertion at C terminus
Vector Backbone Description: Backbone Marker:Twist Biosciences; Vector Backbone:pTwist Amp High Copy; Vector Types:CRISPR; Bacterial Resistance:Ampicillin
Defining Citation: PMID:39742809
Proper citation: RRID:Addgene_227925 Copy
Species: Homo sapiens
Genetic Insert: CTNNA1 (alpha-catenin) Human
Vector Backbone Description: Backbone Size:4003; Vector Backbone:pEGFP-C1; Vector Types:Mammalian Expression; Bacterial Resistance:Kanamycin
Defining Citation: PMID:37480844
Proper citation: RRID:Addgene_229709 Copy
Species: Saccharomyces cerevisiae
Genetic Insert: Aga2
Vector Backbone Description: Backbone Size:5740; Vector Backbone:pETcon(-); Vector Types:Yeast Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:38116434
Proper citation: RRID:Addgene_225229 Copy
Species: Homo sapiens
Genetic Insert: MARK2-CR
Vector Backbone Description: Vector Backbone:LentiVi; Vector Types:Mammalian Expression, Lentiviral; Bacterial Resistance:Ampicillin
Defining Citation: PMID:39058094
Proper citation: RRID:Addgene_229421 Copy
Species: Saccharomyces cerevisiae
Genetic Insert: Aga2
Vector Backbone Description: Backbone Size:5740; Vector Backbone:pETcon(-); Vector Types:Yeast Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:38116434
Proper citation: RRID:Addgene_225228 Copy
Species: Homo sapiens
Genetic Insert: NaV1.1
Vector Backbone Description: Backbone Marker:Azenta; Vector Backbone:pUC-GW-Amp; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Proper citation: RRID:Addgene_227642 Copy
Species: Homo sapiens
Genetic Insert: FMR1 isoform 1
Vector Backbone Description: Backbone Marker:Mayr Lab; Vector Backbone:pcDNA3-puro; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:37961296
Comments: Resistant to shRNA TRCN0000059759 (target sequence GCGTTTGGAGAGATTACAAAT). Please visit https://doi.org/10.1101/2023.11.05.565677 for bioRxiv preprint.
Proper citation: RRID:Addgene_225468 Copy
Genetic Insert: MYL2, TadA, nSauri Cas9N, inteinN
Vector Backbone Description: Vector Backbone:pAAV-CMV-TadA8e-SpG N aa2-713-InteinN; Vector Types:AAV; Bacterial Resistance:Ampicillin
Defining Citation: PMID:39817340
Proper citation: RRID:Addgene_226678 Copy
Species: Listeria monocytogenes
Genetic Insert: EGFP; Control construct with tandem AP4 motifs (cytoplasm)
Vector Backbone Description: Backbone Size:5401; Vector Backbone:pcDNA 3.1(-) ; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:16371509
Proper citation: RRID:Addgene_229694 Copy
Species: Homo sapiens
Genetic Insert: SORE6
Vector Backbone Description: Backbone Size:2228; Vector Backbone:pDonr-215; Vector Types:Gateway Cloning; Bacterial Resistance:Kanamycin
Defining Citation: PMID:25497455
Comments: Entry clone (4-5): SORE6 consists of 6 repeats of a composite SOX2/OCT4 response element from the human NANOG promoter
Proper citation: RRID:Addgene_225659 Copy
Species: Synthetic
Genetic Insert: Synthetic construct LifeAct-mTurquoise gene
Vector Backbone Description: Backbone Size:8195; Vector Backbone:PLViP; Vector Types:Mammalian Expression, Lentiviral; Bacterial Resistance:Ampicillin
Defining Citation: PMID:37480844
Proper citation: RRID:Addgene_229699 Copy
Species: Homo sapiens
Genetic Insert: CTNNA1 (alpha-catenin) Human
Vector Backbone Description: Backbone Size:4003; Vector Backbone:pEGFP-C1; Vector Types:Mammalian Expression; Bacterial Resistance:Kanamycin
Defining Citation: PMID:37480844
Proper citation: RRID:Addgene_229698 Copy
Genetic Insert: nDivA-BE
Vector Backbone Description: Vector Backbone:pGH483; Vector Types:Mammalian Expression, Lentiviral; Bacterial Resistance:Ampicillin
Defining Citation: PMID:40613705
Comments: Please visit https://doi.org/10.1101/2024.11.18.621003 for the bioRxiv preprint.
Proper citation: RRID:Addgene_230841 Copy
Species: SARS-CoV2
Genetic Insert: Spike Protein
Vector Backbone Description: Backbone Size:5216; Vector Backbone:AP2u2-mCherry; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:38633598
Proper citation: RRID:Addgene_226456 Copy
Genetic Insert: dCas9
Vector Backbone Description: Vector Backbone:pGH125; Vector Types:Mammalian Expression, Lentiviral; Bacterial Resistance:Ampicillin
Defining Citation: PMID:40613705
Comments: Please visit https://doi.org/10.1101/2024.11.18.621003 for the bioRxiv preprint.
Proper citation: RRID:Addgene_230835 Copy
Genetic Insert: dCas9-AID*
Vector Backbone Description: Vector Backbone:pGH483; Vector Types:Mammalian Expression, Lentiviral; Bacterial Resistance:Ampicillin
Defining Citation: PMID:40613705
Comments: Please visit https://doi.org/10.1101/2024.11.18.621003 for the bioRxiv preprint.
Proper citation: RRID:Addgene_230839 Copy
Genetic Insert: AID*-dCas9
Vector Backbone Description: Vector Backbone:pGH483; Vector Types:Mammalian Expression, Lentiviral; Bacterial Resistance:Ampicillin
Defining Citation: PMID:40613705
Comments: Please visit https://doi.org/10.1101/2024.11.18.621003 for the bioRxiv preprint.
Proper citation: RRID:Addgene_230838 Copy
Can't find your Plasmid?
We recommend that you click next to the search bar to check some helpful tips on searches and refine your search firstly. If you want to find a specific plasmid, it's easier to enter an RRID or an Addgene Catalog Number to search. You can refine the search results using Facets on the left side of the search results page. If you are on the table view, you can also search in a specific column by clicking the column title and enter the keywords.
If you still could not find your plasmid in the search results, please help us by registering it into the system — it's easy. Register it with Addgene.
Welcome to the NIF Resources search. From here you can search through a compilation of resources used by NIF and see how data is organized within our community.
You are currently on the Community Resources tab looking through categories and sources that NIF has compiled. You can navigate through those categories from here or change to a different tab to execute your search through. Each tab gives a different perspective on data.
If you have an account on NIF then you can log in from here to get additional features in NIF such as Collections, Saved Searches, and managing Resources.
Here is the search term that is being executed, you can type in anything you want to search for. Some tips to help searching:
You can save any searches you perform for quick access to later from here.
We recognized your search term and included synonyms and inferred terms along side your term to help get the data you are looking for.
If you are logged into NIF you can add data records to your collections to create custom spreadsheets across multiple sources of data.
Here are the sources that were queried against in your search that you can investigate further.
Here are the categories present within NIF that you can filter your data on
Here are the subcategories present within this category that you can filter your data on
If you have any further questions please check out our FAQs Page to ask questions and see our tutorials. Click this button to view this tutorial again.
Welcome to the Neuroscience Information Framework Project, designed to serve the biomedical research community. NIF maintains the largest searchable collection of neuroscience data, the largest catalog of biomedical resources, and the largest ontology for neuroscience on the web. We welcome all feedback and suggestions and are actively looking for resource providers to make their resources accessible through NIF. Learn about the tools available to help you share your data and discover a dynamic inventory of Web-based neuroscience resources.
