Searching the RRID Resource Information Network
Are you sure you want to leave this community? Leaving the community will revoke any permissions you have been granted in this community.
Species: Homo sapiens
Genetic Insert: CCAAAGTCTTCATACTGCAG
Vector Backbone Description: Vector Backbone:pX330 Addgene #42230; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:37267110
Proper citation: RRID:Addgene_207611 Copy
Species: Homo sapiens
Genetic Insert: Human Argonaute2
Vector Backbone Description: Backbone Size:5413; Vector Backbone:pcDNA3.3; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:39932188
Comments: With engineered orthogonal SUMO_Eu1 (Vera Rodriguez et al., JCB 2019) in N-terminal tag.
Please visit https://doi.org/10.1101/2024.08.19.608718 for bioRxiv preprint.
Proper citation: RRID:Addgene_231383 Copy
Species: Homo sapiens
Genetic Insert: Human Argonaute2
Vector Backbone Description: Backbone Size:5413; Vector Backbone:pcDNA3.3; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:39932188
Comments: With engineered orthogonal SUMO_Eu1 (Vera Rodriguez et al., JCB 2019) in N-terminal tag.
Please visit https://doi.org/10.1101/2024.08.19.608718 for bioRxiv preprint.
Proper citation: RRID:Addgene_231385 Copy
Species: Homo sapiens
Genetic Insert: FXR1 isoform a
Vector Backbone Description: Backbone Marker:Mayr Lab; Vector Backbone:pcDNA3-puro; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:37961296
Comments: Resistant to shRNA TRCN0000164818 (target sequence CCAGCGAATCTCATCACAGTA). Please visit https://doi.org/10.1101/2023.11.05.565677 for bioRxiv preprint.
Proper citation: RRID:Addgene_225455 Copy
Species: Saccharomyces cerevisiae
Genetic Insert: EL222 codon-optimized for budding yeast
Vector Backbone Description: Vector Backbone:EZL105; Vector Types:Yeast Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:41794024
Comments: For a single-copy integration in budding yeast, the plasmid should be cut with PmeI (double-cutter). Please visit https://doi.org/10.1101/2024.02.28.582517 for bioRxiv preprint.
Proper citation: RRID:Addgene_227755 Copy
Species: Synthetic
Genetic Insert: MT1-LaG16-TEVcs-ALFA-hM4D
Vector Backbone Description: Vector Backbone:pAAV; Vector Types:Mammalian Expression, AAV; Bacterial Resistance:Ampicillin
Defining Citation: PMID:39633047
Proper citation: RRID:Addgene_230008 Copy
Species: Saccharomyces cerevisiae
Genetic Insert: EL222 codon-optimized for budding yeast
Vector Backbone Description: Vector Backbone:EZL105; Vector Types:Yeast Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:41794024
Comments: For a single-copy integration in budding yeast, the plasmid should be cut with PmeI (double-cutter). Please visit https://doi.org/10.1101/2024.02.28.582517 for bioRxiv preprint.
Proper citation: RRID:Addgene_227757 Copy
Species: Homo sapiens
Genetic Insert: HaloTag-MDC1
Vector Backbone Description: Backbone Size:5000; Vector Backbone:pHTN HaloTag CMV-neo (Promega; #G7721); Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:37341699
Proper citation: RRID:Addgene_207108 Copy
Species: Saccharomyces cerevisiae
Genetic Insert: EL222 codon-optimized for budding yeast
Vector Backbone Description: Vector Backbone:EZL105; Vector Types:Yeast Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:41794024
Comments: For a single-copy integration in budding yeast, the plasmid should be cut with PmeI (double-cutter). Please visit https://doi.org/10.1101/2024.02.28.582517 for bioRxiv preprint.
Proper citation: RRID:Addgene_227759 Copy
Species: Homo sapiens
Genetic Insert: HaloTag with internal PuroR cassette flanked by human SHLD3 locus sequences
Vector Backbone Description: Backbone Size:4997; Vector Backbone:pFastBac dual; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:37341699
Proper citation: RRID:Addgene_207077 Copy
Species: Caenorhabditis elegans
Genetic Insert: Pgpc-1 wCherry unc-54 3' UTR
Vector Backbone Description: Backbone Marker:stratagene; Backbone Size:8784; Vector Backbone:pBSK; Vector Types:Worm Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:36857454
Comments: Please visit for https://www.biorxiv.org/content/10.1101/2021.09.21.461278v4 bioRxiv preprint.
There is a single nt discrepancy in Pgpc-1. This does not affect the plasmid's function.
Proper citation: RRID:Addgene_229803 Copy
Species: Homo sapiens
Genetic Insert: HaloTag followed by a PolyA signal and PuroR cassette flanked by human ATM locus sequences
Vector Backbone Description: Backbone Size:5000; Vector Backbone:pFastBac dual; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:37341699
Proper citation: RRID:Addgene_207082 Copy
Species: Homo sapiens
Genetic Insert: HaloTag with internal PuroR cassette flanked by human 53BP1 locus sequences
Vector Backbone Description: Backbone Size:5000; Vector Backbone:pFastBac dual; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:37341699
Proper citation: RRID:Addgene_207087 Copy
Species: Solanum lycopersicum
Genetic Insert: mobile gRNA targeting SlCHL1
Vector Backbone Description: Vector Backbone:pEE844; Vector Types:Plant Expression; Bacterial Resistance:Kanamycin
Defining Citation: PMID:39284063
Comments: also contains mobile sequences from tRNAIleu
Proper citation: RRID:Addgene_231162 Copy
Species: Homo sapiens
Genetic Insert: HaloTag with internal PuroR cassette flanked by human MDC1 locus sequences
Vector Backbone Description: Backbone Size:5500; Vector Backbone:pFastBac dual; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:37341699
Proper citation: RRID:Addgene_207086 Copy
Species: Solanum lycopersicum
Genetic Insert: mobile gRNA targeting SlPDS
Vector Backbone Description: Vector Backbone:pEE083; Vector Types:Plant Expression; Bacterial Resistance:Kanamycin
Defining Citation: PMID:39284063
Comments: also contains mobile sequences from Arabidopsis thaliana FT mRNA
Proper citation: RRID:Addgene_231168 Copy
Species: Lama glama
Genetic Insert: GST-5
Vector Backbone Description: Backbone Marker:Novagen; Backbone Size:5443; Vector Backbone:pET21a(+); Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:39098531
Proper citation: RRID:Addgene_228987 Copy
Species: Mus musculus
Genetic Insert: SOX9-noHMG
Vector Backbone Description: Backbone Size:-2; Vector Backbone:pLKO; Vector Types:Lentiviral; Bacterial Resistance:Ampicillin
Defining Citation: PMID:37488435
Proper citation: RRID:Addgene_203964 Copy
Species: Mus musculus
Genetic Insert: ARID1A
Vector Backbone Description: Backbone Size:0; Vector Backbone:PT5; Vector Types:Mammalian Expression, SLEEPING BEAUTY TRANSPOSON; Bacterial Resistance:Ampicillin
Defining Citation: PMID:37488435
Proper citation: RRID:Addgene_203965 Copy
Species: Saccharomyces cerevisiae
Genetic Insert: EL222 codon-optimized for budding yeast
Vector Backbone Description: Vector Backbone:EZL105; Vector Types:Yeast Expression; Bacterial Resistance:Ampicillin
Comments: For a single-copy integration in budding yeast, the plasmid should be cut with PmeI (double-cutter). Please visit https://doi.org/10.1101/2024.02.28.582517 for bioRxiv preprint.
Proper citation: RRID:Addgene_227770 Copy
Can't find your Plasmid?
We recommend that you click next to the search bar to check some helpful tips on searches and refine your search firstly. If you want to find a specific plasmid, it's easier to enter an RRID or an Addgene Catalog Number to search. You can refine the search results using Facets on the left side of the search results page. If you are on the table view, you can also search in a specific column by clicking the column title and enter the keywords.
If you still could not find your plasmid in the search results, please help us by registering it into the system — it's easy. Register it with Addgene.
Welcome to the NIF Resources search. From here you can search through a compilation of resources used by NIF and see how data is organized within our community.
You are currently on the Community Resources tab looking through categories and sources that NIF has compiled. You can navigate through those categories from here or change to a different tab to execute your search through. Each tab gives a different perspective on data.
If you have an account on NIF then you can log in from here to get additional features in NIF such as Collections, Saved Searches, and managing Resources.
Here is the search term that is being executed, you can type in anything you want to search for. Some tips to help searching:
You can save any searches you perform for quick access to later from here.
We recognized your search term and included synonyms and inferred terms along side your term to help get the data you are looking for.
If you are logged into NIF you can add data records to your collections to create custom spreadsheets across multiple sources of data.
Here are the sources that were queried against in your search that you can investigate further.
Here are the categories present within NIF that you can filter your data on
Here are the subcategories present within this category that you can filter your data on
If you have any further questions please check out our FAQs Page to ask questions and see our tutorials. Click this button to view this tutorial again.
Welcome to the Neuroscience Information Framework Project, designed to serve the biomedical research community. NIF maintains the largest searchable collection of neuroscience data, the largest catalog of biomedical resources, and the largest ontology for neuroscience on the web. We welcome all feedback and suggestions and are actively looking for resource providers to make their resources accessible through NIF. Learn about the tools available to help you share your data and discover a dynamic inventory of Web-based neuroscience resources.
