Searching the RRID Resource Information Network

Our searching services are busy right now. Please try again later

  • Register
X
Forgot Password

If you have forgotten your password you can enter your email here and get a temporary password sent to your email.

X

Leaving Community

Are you sure you want to leave this community? Leaving the community will revoke any permissions you have been granted in this community.

No
Yes

Plasmids are provided by Addgene and DGRC.

Search

Type in a keyword to search

On page 460 showing 9181 ~ 9200 out of 742,877 results
Snippet view Table view Download Top 1000 Results
Click the to add this resource to a Collection
  • RRID:Addgene_238033

http://www.addgene.org/238033

Species: Synthetic
Genetic Insert: sfGFP
Vector Backbone Description: Backbone Size:3283; Vector Backbone:ADEPT-pTarget; Vector Types:Synthetic Biology; Bacterial Resistance:Kanamycin
Defining Citation: PMID:39779901
Comments: gRNA sequence: guuuuagagcuagaaauagcaaguuaaaauaaggcuaguccguuaucaacuugaaaaaguggcaccgagucggugc

Proper citation: RRID:Addgene_238033 Copy   


http://www.addgene.org/228825

Species: Orientia tsutsugamushi
Genetic Insert: ScaD
Vector Backbone Description: Vector Backbone:pCDNA5/FRT/TO; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Comments: Please visit https://doi.org/10.1101/2024.04.11.589026 for bioRxiv preprint.

Proper citation: RRID:Addgene_228825 Copy   


http://www.addgene.org/228826

Species: Orientia tsutsugamushi
Genetic Insert: ScaE
Vector Backbone Description: Vector Backbone:pCDNA5/FRT/TO; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Comments: Please visit https://doi.org/10.1101/2024.04.11.589026 for bioRxiv preprint.

Proper citation: RRID:Addgene_228826 Copy   


http://www.addgene.org/228827

Species: Orientia tsutsugamushi
Genetic Insert: ScaC
Vector Backbone Description: Vector Backbone:pCDNA5/FRT/TO; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Comments: Please visit https://doi.org/10.1101/2024.04.11.589026 for bioRxiv preprint.

Proper citation: RRID:Addgene_228827 Copy   


  • RRID:Addgene_210295

http://www.addgene.org/210295

Species: Synthetic
Genetic Insert: mActA-FKBP-mCherry
Vector Backbone Description: Backbone Marker:Clontech; Backbone Size:4700; Vector Backbone:pmCherry-N1; Vector Types:Mammalian Expression; Bacterial Resistance:Kanamycin
Defining Citation: PMID:37734382

Proper citation: RRID:Addgene_210295 Copy   


http://www.addgene.org/218857

Species: Homo sapiens
Genetic Insert: hGCGR
Vector Backbone Description: Vector Backbone:Tol2 pDest; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:39702668
Comments: Please visit https://pubmed.ncbi.nlm.nih.gov/37066422/ for bioRxiv preprint.

Proper citation: RRID:Addgene_218857 Copy   


  • RRID:Addgene_210290

http://www.addgene.org/210290

Species: Synthetic
Genetic Insert: ECFP-FRB-Sec61b
Vector Backbone Description: Backbone Marker:Clontech; Backbone Size:4700; Vector Backbone:ECFP-C1; Vector Types:Mammalian Expression; Bacterial Resistance:Kanamycin
Defining Citation: PMID:37734382

Proper citation: RRID:Addgene_210290 Copy   


  • RRID:Addgene_210291

http://www.addgene.org/210291

Species: Synthetic
Genetic Insert: Tom20-EYFP-miLID
Vector Backbone Description: Backbone Marker:Clontech; Backbone Size:4700; Vector Backbone:EYFP-C1; Vector Types:Mammalian Expression; Bacterial Resistance:Kanamycin
Defining Citation: PMID:37734382

Proper citation: RRID:Addgene_210291 Copy   


http://www.addgene.org/210867

Genetic Insert: mNeongreen
Vector Backbone Description: Vector Backbone:pJM220; Vector Types:Bacterial Expression; Bacterial Resistance:Gentamicin
Defining Citation: PMID:38319019
Comments: The promoter sequence comes from: https://doi.org/10.1021/acssynbio.5b00058

Proper citation: RRID:Addgene_210867 Copy   


http://www.addgene.org/218860

Species: Homo sapiens
Genetic Insert: hGCG-ICAM(1235)-nrxn1b
Vector Backbone Description: Vector Backbone:Tol2 pDest; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:39702668
Comments: Please visit https://pubmed.ncbi.nlm.nih.gov/37066422/ for bioRxiv preprint.

Proper citation: RRID:Addgene_218860 Copy   


  • RRID:Addgene_228689

http://www.addgene.org/228689

Species: Synthetic
Genetic Insert: 2xProtein A-TEV
Vector Backbone Description: Vector Backbone:pYTK001; Vector Types:Insect Expression; Bacterial Resistance:Chloramphenicol
Defining Citation: PMID:39814169

Proper citation: RRID:Addgene_228689 Copy   


http://www.addgene.org/228833

Species: Mus musculus
Genetic Insert: BICD2
Vector Backbone Description: Vector Backbone:pACEBac1; Vector Types:Insect Expression; Bacterial Resistance:Gentamicin
Comments: Please visit https://doi.org/10.1101/2024.04.11.589026 for bioRxiv preprint.

Proper citation: RRID:Addgene_228833 Copy   


  • RRID:Addgene_191443

http://www.addgene.org/191443

Species: Homo sapiens
Genetic Insert: Human Talin1 R12DD
Vector Backbone Description: Backbone Size:5658; Vector Backbone:pET151; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:39704176
Comments: Please visit https://doi.org/10.1101/2022.10.17.22280833 for medRxiv preprint.

Proper citation: RRID:Addgene_191443 Copy   


http://www.addgene.org/228835

Species: Orientia tsutsugamushi
Genetic Insert: ScaC
Vector Backbone Description: Vector Backbone:pET22b; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin
Comments: Please visit https://doi.org/10.1101/2024.04.11.589026 for bioRxiv preprint.

Proper citation: RRID:Addgene_228835 Copy   


http://www.addgene.org/228838

Species: Mus musculus
Genetic Insert: BICD2
Vector Backbone Description: Vector Backbone:pACEBac1; Vector Types:Insect Expression; Bacterial Resistance:Gentamicin
Comments: Please visit https://doi.org/10.1101/2024.04.11.589026 for bioRxiv preprint.

Proper citation: RRID:Addgene_228838 Copy   


  • RRID:Addgene_144011

http://www.addgene.org/144011

Species: Homo sapiens
Genetic Insert: TAF1
Vector Backbone Description: Backbone Marker:Broad Institute Genetic Perturbation Platform; Backbone Size:8264; Vector Backbone:pLX_TRC317; Vector Types:Mammalian Expression, Lentiviral; Bacterial Resistance:Ampicillin
Defining Citation: PMID:36608654
Comments: Transcript includes additional 20 amino acids on N-term compared to NM_004606. ENST00000276072. The transcription factor ORF portion of this plasmid was synthesized by Genewiz. Please test multiple small colonies in case of plasmid recombination. To make this collection available in a timely manner, a portion of this collection was not fully sequenced by Addgene. If an Addgene verified full plasmid sequence is not available, please contact us at [email protected] prior to placing an order to request the full sequence.

Proper citation: RRID:Addgene_144011 Copy   


http://www.addgene.org/222695

Vector Backbone Description: Vector Backbone:FUW; Vector Types:Mammalian Expression, Lentiviral, CRISPR; Bacterial Resistance:Ampicillin and Bleocin (Zeocin)
Defining Citation: PMID:39681701

Proper citation: RRID:Addgene_222695 Copy   


http://www.addgene.org/214687

Species: Homo sapiens
Genetic Insert: dgRNA_TP73
Vector Backbone Description: Vector Backbone:pDual_dsCas9_BFP; Vector Types:Lentiviral, CRISPR; Bacterial Resistance:Ampicillin

Proper citation: RRID:Addgene_214687 Copy   


http://www.addgene.org/214689

Species: Homo sapiens
Genetic Insert: dgRNA_TP73
Vector Backbone Description: Vector Backbone:pDual_dsCas9_Puro; Vector Types:Lentiviral, CRISPR; Bacterial Resistance:Ampicillin

Proper citation: RRID:Addgene_214689 Copy   


  • RRID:Addgene_228681

http://www.addgene.org/228681

Species: Saccharomyces cerevisiae
Genetic Insert: pCCW12
Vector Backbone Description: Vector Backbone:pYTK001; Vector Types:Yeast Expression; Bacterial Resistance:Chloramphenicol
Defining Citation: PMID:39814169

Proper citation: RRID:Addgene_228681 Copy   



Can't find your Plasmid?

We recommend that you click next to the search bar to check some helpful tips on searches and refine your search firstly. If you want to find a specific plasmid, it's easier to enter an RRID or an Addgene Catalog Number to search. You can refine the search results using Facets on the left side of the search results page. If you are on the table view, you can also search in a specific column by clicking the column title and enter the keywords.

If you still could not find your plasmid in the search results, please help us by registering it into the system — it's easy. Register it with Addgene.

Can't find the RRID you're searching for? X
  1. Neuroscience Information Framework Resources

    Welcome to the NIF Resources search. From here you can search through a compilation of resources used by NIF and see how data is organized within our community.

  2. Navigation

    You are currently on the Community Resources tab looking through categories and sources that NIF has compiled. You can navigate through those categories from here or change to a different tab to execute your search through. Each tab gives a different perspective on data.

  3. Logging in and Registering

    If you have an account on NIF then you can log in from here to get additional features in NIF such as Collections, Saved Searches, and managing Resources.

  4. Searching

    Here is the search term that is being executed, you can type in anything you want to search for. Some tips to help searching:

    1. Use quotes around phrases you want to match exactly
    2. You can manually AND and OR terms to change how we search between words
    3. You can add "-" to terms to make sure no results return with that term in them (ex. Cerebellum -CA1)
    4. You can add "+" to terms to require they be in the data
    5. Using autocomplete specifies which branch of our semantics you with to search and can help refine your search
  5. Save Your Search

    You can save any searches you perform for quick access to later from here.

  6. Query Expansion

    We recognized your search term and included synonyms and inferred terms along side your term to help get the data you are looking for.

  7. Collections

    If you are logged into NIF you can add data records to your collections to create custom spreadsheets across multiple sources of data.

  8. Sources

    Here are the sources that were queried against in your search that you can investigate further.

  9. Categories

    Here are the categories present within NIF that you can filter your data on

  10. Subcategories

    Here are the subcategories present within this category that you can filter your data on

  11. Further Questions

    If you have any further questions please check out our FAQs Page to ask questions and see our tutorials. Click this button to view this tutorial again.

X