Searching the RRID Resource Information Network

Our searching services are busy right now. Please try again later

  • Register
X
Forgot Password

If you have forgotten your password you can enter your email here and get a temporary password sent to your email.

X

Leaving Community

Are you sure you want to leave this community? Leaving the community will revoke any permissions you have been granted in this community.

No
Yes

Plasmids are provided by Addgene and DGRC.

Search

Type in a keyword to search

On page 441 showing 8801 ~ 8820 out of 12,959 results
Snippet view Table view Download Top 1000 Results
Click the to add this resource to a Collection

http://www.addgene.org/32488

Species: Mus musculus
Genetic Insert: GPD1L 3'UTR
Vector Backbone Description: Backbone Marker:Invitrogen; Backbone Size:5400; Vector Backbone:pcDNA3; Vector Types:Mammalian Expression, Luciferase; Bacterial Resistance:Ampicillin
Defining Citation: PMID:21555452

Proper citation: RRID:Addgene_32488 Copy   


  • RRID:Addgene_32515

    This resource has 1+ mentions.

http://www.addgene.org/32515

Species: Mus musculus
Genetic Insert: Mef2c
Vector Backbone Description: Backbone Marker:Invitrogen; Backbone Size:5400; Vector Backbone:pcDNA3.1; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:19704004

Proper citation: RRID:Addgene_32515 Copy   


  • RRID:Addgene_32517

http://www.addgene.org/32517

Species: Mus musculus
Genetic Insert: Pax3
Vector Backbone Description: Backbone Marker:Addgene plasmid #32516; Backbone Size:7900; Vector Backbone:pOZ-FH-C-Puro; Vector Types:Mammalian Expression, Retroviral; Bacterial Resistance:Ampicillin
Defining Citation: PMID:19458195

Proper citation: RRID:Addgene_32517 Copy   


http://www.addgene.org/32460

Species: Mus musculus
Genetic Insert: Calcium/Calmodulin dependent protein kinase kinase beta
Vector Backbone Description: Backbone Size:8000; Vector Backbone:pRRLsin.PPT.hPGK.FLAG-CaMKKbeta-IRES.GFP; Vector Types:Lentiviral; Bacterial Resistance:Ampicillin
Defining Citation: PMID:21669867

Proper citation: RRID:Addgene_32460 Copy   


http://www.addgene.org/32579

Species: Mus musculus
Genetic Insert: CAMKIIalpha promoter 0.4kb version
Vector Backbone Description: Backbone Marker:Invitrogen; Vector Backbone:pDONR221 P1-P4; Vector Types:Gateway Cloning; Bacterial Resistance:Kanamycin
Defining Citation: PMID:21772812

Proper citation: RRID:Addgene_32579 Copy   


  • RRID:Addgene_32607

http://www.addgene.org/32607

Species: Mus musculus
Genetic Insert: TTR:mRFP
Vector Backbone Description: Vector Backbone:pTTR1ExV3; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:19415627
Comments: The Ttr::RFP constructs were generated by inserting a 1-kb mRFP1 (Campbell et al., 2002) fragment into either the NruI site of the first exon or StuI site of the second exon of pTTR1ExV3 (Costa et al., 1990).

Proper citation: RRID:Addgene_32607 Copy   


  • RRID:Addgene_32606

    This resource has 1+ mentions.

http://www.addgene.org/32606

Species: Mus musculus
Genetic Insert: TTR:Cre
Vector Backbone Description: Vector Backbone:pTTR1ExV3; Vector Types:; Bacterial Resistance:Ampicillin
Defining Citation: PMID:19415627
Comments: The Ttr::Cre construct was generated by inserting a 1.1 kb nlsCre (Lewandoski et al., 1997) fragment into the second exon of pTTR1ExV3 (Costa et al., 1990).

Proper citation: RRID:Addgene_32606 Copy   


  • RRID:Addgene_32856

    This resource has 1+ mentions.

http://www.addgene.org/32856

Species: Mus musculus
Genetic Insert: Talin-1 Head aa 1-433
Vector Backbone Description: Backbone Marker:BD Clontech; Backbone Size:4749; Vector Backbone:pEGFP-C1; Vector Types:Mammalian Expression; Bacterial Resistance:Kanamycin
Defining Citation: PMID:17114441
Comments: Please note that the most appropriate reference sequence for the Talin1 insert in this plasmid is GenBank accession number CAA39588.1

Proper citation: RRID:Addgene_32856 Copy   


http://www.addgene.org/32706

Species: Mus musculus
Genetic Insert: solute carrier family 9 (sodium/hydrogen exchanger), member 3 regulator 1
Vector Backbone Description: Backbone Marker:Invitrogen; Backbone Size:5600; Vector Backbone:pcDNA3.1/Hygro(+); Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:11457730

Proper citation: RRID:Addgene_32706 Copy   


  • RRID:Addgene_32806

    This resource has 1+ mentions.

http://www.addgene.org/32806

Species: Mus musculus
Genetic Insert: Smad3
Vector Backbone Description: Backbone Marker:Clontech; Backbone Size:6600; Vector Backbone:pSIREN-DNR-DsRed; Vector Types:Mammalian Expression, RNAi; Bacterial Resistance:Ampicillin
Comments: Primers used to generate shRNA: Upper: 5’– GATCCACCTGAGTGAAGATGGAGATTCAAGAGATCTCCATCTTCACTCAGGTTTTTTTACGCGTG–3’ Lower: 3’– AATTCACGCGTAAAAAAACCTGAGTGAAGATGGAGATCTCTTGAATCTCCATCTTCACTCAGGTG-5'

Proper citation: RRID:Addgene_32806 Copy   


  • RRID:Addgene_32978

    This resource has 1+ mentions.

http://www.addgene.org/32978

Species: Mus musculus
Genetic Insert: Mcl-1
Vector Backbone Description: Backbone Marker:Sigma; Backbone Size:6307; Vector Backbone:p3XFlag-CMV10; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:20385764

Proper citation: RRID:Addgene_32978 Copy   


  • RRID:Addgene_33013

    This resource has 1+ mentions.

http://www.addgene.org/33013

Species: Mus musculus
Genetic Insert: LIM homeobox transcription factor 1 alpha
Vector Backbone Description: Backbone Marker:Malin Parmar; Backbone Size:7041; Vector Backbone:pCCL-cppt-PGK-WPRE; Vector Types:Mammalian Expression, Lentiviral; Bacterial Resistance:Ampicillin
Defining Citation: PMID:21646515

Proper citation: RRID:Addgene_33013 Copy   


  • RRID:Addgene_33014

    This resource has 1+ mentions.

http://www.addgene.org/33014

Species: Mus musculus
Genetic Insert: Forkhead box A2
Vector Backbone Description: Backbone Marker:Malin Parmar; Backbone Size:7041; Vector Backbone:pCCL-cppt-PGK-WPRE; Vector Types:Mammalian Expression, Lentiviral; Bacterial Resistance:Ampicillin
Defining Citation: PMID:21646515
Comments: Please note that Addgene's sequencing data shows a H10L mutation is present compared to the depositor's sequence. This mutation is a known variant of mouse Foxa2 (GenBank: CAA52891.1).

Proper citation: RRID:Addgene_33014 Copy   


  • RRID:Addgene_32964

http://www.addgene.org/32964

Species: Mus musculus
Genetic Insert: MEF2D
Vector Backbone Description: Backbone Marker:Sigma; Backbone Size:4700; Vector Backbone:p3XFlag-CMV-7.1; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin

Proper citation: RRID:Addgene_32964 Copy   


  • RRID:Addgene_33007

    This resource has 1+ mentions.

http://www.addgene.org/33007

Species: Mus musculus
Genetic Insert: forkhead box A1
Vector Backbone Description: Vector Backbone:pGCDNsam; Vector Types:Retroviral; Bacterial Resistance:Ampicillin
Defining Citation: PMID:21716291

Proper citation: RRID:Addgene_33007 Copy   


  • RRID:Addgene_33004

    This resource has 1+ mentions.

http://www.addgene.org/33004

Species: Mus musculus
Genetic Insert: forkhead box A2
Vector Backbone Description: Vector Backbone:pGCDNsam; Vector Types:Retroviral; Bacterial Resistance:Ampicillin
Defining Citation: PMID:21716291

Proper citation: RRID:Addgene_33004 Copy   


  • RRID:Addgene_33005

http://www.addgene.org/33005

Species: Mus musculus
Genetic Insert: forkhead box A3
Vector Backbone Description: Vector Backbone:pGCDNsam; Vector Types:Retroviral; Bacterial Resistance:Ampicillin
Defining Citation: PMID:21716291

Proper citation: RRID:Addgene_33005 Copy   


  • RRID:Addgene_33009

    This resource has 1+ mentions.

http://www.addgene.org/33009

Species: Mus musculus
Genetic Insert: forkhead box A3
Vector Backbone Description: Vector Backbone:pGCDNsam; Vector Types:Retroviral; Bacterial Resistance:Ampicillin
Defining Citation: PMID:21716291

Proper citation: RRID:Addgene_33009 Copy   


  • RRID:Addgene_32930

http://www.addgene.org/32930

Species: Mus musculus
Genetic Insert: Hb9
Vector Backbone Description: Backbone Size:4800; Vector Backbone:pMXs; Vector Types:Mammalian Expression, Retroviral; Bacterial Resistance:Ampicillin
Defining Citation: PMID:21852222

Proper citation: RRID:Addgene_32930 Copy   


  • RRID:Addgene_32931

http://www.addgene.org/32931

Species: Mus musculus
Genetic Insert: Sox1
Vector Backbone Description: Backbone Size:4800; Vector Backbone:pMXs; Vector Types:Mammalian Expression, Retroviral; Bacterial Resistance:Ampicillin
Defining Citation: PMID:21852222

Proper citation: RRID:Addgene_32931 Copy   



Can't find your Plasmid?

We recommend that you click next to the search bar to check some helpful tips on searches and refine your search firstly. If you want to find a specific plasmid, it's easier to enter an RRID or an Addgene Catalog Number to search. You can refine the search results using Facets on the left side of the search results page. If you are on the table view, you can also search in a specific column by clicking the column title and enter the keywords.

If you still could not find your plasmid in the search results, please help us by registering it into the system — it's easy. Register it with Addgene.

Can't find the RRID you're searching for? X
  1. Neuroscience Information Framework Resources

    Welcome to the NIF Resources search. From here you can search through a compilation of resources used by NIF and see how data is organized within our community.

  2. Navigation

    You are currently on the Community Resources tab looking through categories and sources that NIF has compiled. You can navigate through those categories from here or change to a different tab to execute your search through. Each tab gives a different perspective on data.

  3. Logging in and Registering

    If you have an account on NIF then you can log in from here to get additional features in NIF such as Collections, Saved Searches, and managing Resources.

  4. Searching

    Here is the search term that is being executed, you can type in anything you want to search for. Some tips to help searching:

    1. Use quotes around phrases you want to match exactly
    2. You can manually AND and OR terms to change how we search between words
    3. You can add "-" to terms to make sure no results return with that term in them (ex. Cerebellum -CA1)
    4. You can add "+" to terms to require they be in the data
    5. Using autocomplete specifies which branch of our semantics you with to search and can help refine your search
  5. Save Your Search

    You can save any searches you perform for quick access to later from here.

  6. Query Expansion

    We recognized your search term and included synonyms and inferred terms along side your term to help get the data you are looking for.

  7. Collections

    If you are logged into NIF you can add data records to your collections to create custom spreadsheets across multiple sources of data.

  8. Sources

    Here are the sources that were queried against in your search that you can investigate further.

  9. Categories

    Here are the categories present within NIF that you can filter your data on

  10. Subcategories

    Here are the subcategories present within this category that you can filter your data on

  11. Further Questions

    If you have any further questions please check out our FAQs Page to ask questions and see our tutorials. Click this button to view this tutorial again.

X